EMAIL THIS PAGE TO A FRIEND

ZBTB34

zinc finger and BTB domain containing 34

Synonyms: RP11-106H5.1 ZNF918
UniProtKB ID: Q8NCN2, Q38IA7, Q5VYE9
Gene ID:
Mouse(241311) zinc finger and BTB domain containing 34
Rat(689174) zinc finger and BTB domain containing 34
domestic guinea pig(100727675) zinc finger and BTB domain containing 34
Domestic Rabbit(100358201) zinc finger and BTB domain containing 34
naked mole-rat(101706742) zinc finger and BTB domain containing 34
cow(518084) zinc finger and BTB domain containing 34
sheep(101111357) zinc finger and BTB domain containing 34
Zebrafish(573972) zinc finger and BTB domain containing 34
chicken(417090) zinc finger and BTB domain containing 34
dog(491331) zinc finger and BTB domain containing 34
Horse(100070589) zinc finger and BTB domain containing 34
domestic cat(101087110) zinc finger and BTB domain containing 34
307 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA023893 Anti-ZBTB34 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001099270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001099270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001099270 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085507 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085507 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085507 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099270 Rosetta Predictions human pricing
XM_928961 Rosetta Predictions human pricing
XM_001069858 Rosetta Predictions rat pricing
NM_001085507 Rosetta Predictions mouse pricing
XM_140881 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320297 predicted 1629
2 SASI_Hs02_00320298 predicted 498
3 SASI_Hs02_00320299 predicted 1068
4 SASI_Hs02_00320300 predicted 544
5 SASI_Hs02_00320301 predicted 555
6 SASI_Hs02_00320302 predicted 296
7 SASI_Hs02_00320303 predicted 579
8 SASI_Hs02_00320304 predicted 1194
9 SASI_Hs02_00320305 predicted 1624
10 SASI_Hs02_00320306 predicted 1200
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00251800 predicted 1535
2 SASI_Hs01_00251801 predicted 792
3 SASI_Hs01_00251802 predicted 826
4 SASI_Hs01_00251803 predicted 586
5 SASI_Hs01_00251804 predicted 867
6 SASI_Hs01_00251805 predicted 613
7 SASI_Hs01_00251806 predicted 1186
8 SASI_Hs01_00251807 predicted 1482
9 SASI_Hs01_00251808 predicted 1495
10 SASI_Hs01_00251809 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069858 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329617 predicted 1722
2 SASI_Rn02_00329618 predicted 1111
3 SASI_Rn02_00329619 predicted 1664
4 SASI_Rn02_00329620 predicted 750
5 SASI_Rn02_00329621 predicted 223
6 SASI_Rn02_00329622 predicted 324
7 SASI_Rn02_00329623 predicted 528
8 SASI_Rn02_00329624 predicted 1146
9 SASI_Rn02_00329625 predicted 304
10 SASI_Rn02_00329626 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085507 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300652 predicted 1631
2 SASI_Mm02_00300653 predicted 426
3 SASI_Mm02_00300654 predicted 857
4 SASI_Mm02_00300655 predicted 395
5 SASI_Mm02_00300656 predicted 896
6 SASI_Mm02_00300657 predicted 1430
7 SASI_Mm02_00300658 predicted 1341
8 SASI_Mm02_00300659 predicted 1657
9 SASI_Mm02_00300660 predicted 407
10 SASI_Mm02_00300661 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_140881 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215433 predicted 1635
2 SASI_Mm01_00215434 predicted 435
3 SASI_Mm01_00215435 predicted 858
4 SASI_Mm01_00215436 predicted 638
5 SASI_Mm01_00215437 predicted 396
6 SASI_Mm01_00215438 predicted 1428
7 SASI_Mm01_00215439 predicted 1347
8 SASI_Mm01_00215440 predicted 1664
9 SASI_Mm01_00215441 predicted 407
10 SASI_Mm01_00215442 predicted 1629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001099270
VALIDATED
ZBTB34 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 34
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-752s21c1
Sequence:CCGGCATGAGCAAGGAGACCTATTGCTCGAGCAATAGGTCTCCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-1580s21c1
Sequence:CCGGGTGTCTGATGCTCCCGATTAACTCGAGTTAATCGGGAGCATCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-1261s21c1
Sequence:CCGGTAGGCACATGCGACTCCATATCTCGAGATATGGAGTCGCATGTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099270.1-267s21c1
Sequence:CCGGTCCGGGACCATTCAGCGTTAACTCGAGTTAACGCTGAATGGTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-4109s21c1
Sequence:CCGGTTGTCCGTCTTAACCTTATTTCTCGAGAAATAAGGTTAAGACGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001099270
VALIDATED
ZBTB34 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 34
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-752s21c1
Sequence:CCGGCATGAGCAAGGAGACCTATTGCTCGAGCAATAGGTCTCCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-1580s21c1
Sequence:CCGGGTGTCTGATGCTCCCGATTAACTCGAGTTAATCGGGAGCATCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-1261s21c1
Sequence:CCGGTAGGCACATGCGACTCCATATCTCGAGATATGGAGTCGCATGTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099270.1-267s21c1
Sequence:CCGGTCCGGGACCATTCAGCGTTAACTCGAGTTAACGCTGAATGGTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-4109s21c1
Sequence:CCGGTTGTCCGTCTTAACCTTATTTCTCGAGAAATAAGGTTAAGACGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001099270
VALIDATED
ZBTB34 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 34
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-752s21c1
Sequence:CCGGCATGAGCAAGGAGACCTATTGCTCGAGCAATAGGTCTCCTTGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-1580s21c1
Sequence:CCGGGTGTCTGATGCTCCCGATTAACTCGAGTTAATCGGGAGCATCAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-1261s21c1
Sequence:CCGGTAGGCACATGCGACTCCATATCTCGAGATATGGAGTCGCATGTGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001099270.1-267s21c1
Sequence:CCGGTCCGGGACCATTCAGCGTTAACTCGAGTTAACGCTGAATGGTCCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254268    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001099270.1-4109s21c1
Sequence:CCGGTTGTCCGTCTTAACCTTATTTCTCGAGAAATAAGGTTAAGACGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085507
ZBTB34 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 34
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085507.1-4572s21c1
Sequence:CCGGATAGCGCAGCAGCGGTTAATTCTCGAGAATTAACCGCTGCTGCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-664s21c1
Sequence:CCGGAGAATCCTGAGAGCCGAAATGCTCGAGCATTTCGGCTCTCAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-1272s21c1
Sequence:CCGGATGATGAACAATCCCGGTTATCTCGAGATAACCGGGATTGTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-441s21c1
Sequence:CCGGTTGTCGATCTCTGTGATTAAGCTCGAGCTTAATCACAGAGATCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-285s21c1
Sequence:CCGGACGGTTCTGAGCCAACTAAATCTCGAGATTTAGTTGGCTCAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085507
ZBTB34 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 34
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085507.1-4572s21c1
Sequence:CCGGATAGCGCAGCAGCGGTTAATTCTCGAGAATTAACCGCTGCTGCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-664s21c1
Sequence:CCGGAGAATCCTGAGAGCCGAAATGCTCGAGCATTTCGGCTCTCAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-1272s21c1
Sequence:CCGGATGATGAACAATCCCGGTTATCTCGAGATAACCGGGATTGTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-441s21c1
Sequence:CCGGTTGTCGATCTCTGTGATTAAGCTCGAGCTTAATCACAGAGATCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-285s21c1
Sequence:CCGGACGGTTCTGAGCCAACTAAATCTCGAGATTTAGTTGGCTCAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085507
ZBTB34 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 34
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085507.1-4572s21c1
Sequence:CCGGATAGCGCAGCAGCGGTTAATTCTCGAGAATTAACCGCTGCTGCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-664s21c1
Sequence:CCGGAGAATCCTGAGAGCCGAAATGCTCGAGCATTTCGGCTCTCAGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-1272s21c1
Sequence:CCGGATGATGAACAATCCCGGTTATCTCGAGATAACCGGGATTGTTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-441s21c1
Sequence:CCGGTTGTCGATCTCTGTGATTAAGCTCGAGCTTAATCACAGAGATCGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085507.1-285s21c1
Sequence:CCGGACGGTTCTGAGCCAACTAAATCTCGAGATTTAGTTGGCTCAGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks