EMAIL THIS PAGE TO A FRIEND

ZBTB38

zinc finger and BTB domain containing 38

Synonyms: CIBZ ZNF921
UniProtKB ID: Q8NAP3, D3DNF6
Gene ID:
Human(253461) Summary: The protein encoded by this gene is a zinc finger transcriptional activator that binds methylated DNA. The encoded protein can form homodimers or heterodimers through the zinc finger domains. In mouse, inhibition of this protein has been associated with apoptosis in some cell types. [provided by RefSeq, Jun 2010]
Mouse(245007) zinc finger and BTB domain containing 38
Rat(315936) zinc finger and BTB domain containing 38
domestic guinea pig(100734466) zinc finger and BTB domain containing 38
Domestic Rabbit(100350097) zinc finger and BTB domain containing 38
naked mole-rat(101723622) zinc finger and BTB domain containing 38
cow(539843) zinc finger and BTB domain containing 38
sheep(101107245) zinc finger and BTB domain containing 38
chicken(424783) zinc finger and BTB domain containing 38
domestic cat(101089542) zinc finger and BTB domain containing 38
Horse(100051476) zinc finger and BTB domain containing 38
dog(477096) zinc finger and BTB domain containing 38
224 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175537 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175537 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175537 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080412 Rosetta Predictions human pricing
XM_929657 Rosetta Predictions human pricing
NM_001012471 Rosetta Predictions rat pricing
NM_175537 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314596 predicted 2775
2 SASI_Hs02_00314597 predicted 1843
3 SASI_Hs02_00314598 predicted 3256
4 SASI_Hs02_00314599 predicted 2443
5 SASI_Hs02_00314600 predicted 3986
6 SASI_Hs02_00314601 predicted 1790
7 SASI_Hs02_00314602 predicted 3079
8 SASI_Hs02_00314603 predicted 1702
9 SASI_Hs02_00314604 predicted 2379
10 SASI_Hs02_00314605 predicted 3346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_929657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283178 predicted 3071
2 SASI_Hs01_00283179 predicted 2882
3 SASI_Hs01_00283180 predicted 3597
4 SASI_Hs01_00283181 predicted 2764
5 SASI_Hs01_00283182 predicted 3038
6 SASI_Hs01_00283183 predicted 2763
7 SASI_Hs01_00283184 predicted 3613
8 SASI_Hs01_00283185 predicted 2787
9 SASI_Hs01_00283186 predicted 3623
10 SASI_Hs01_00283187 predicted 3079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114639 predicted 2463
2 SASI_Rn01_00114640 predicted 1793
3 SASI_Rn01_00114641 predicted 3259
4 SASI_Rn01_00114642 predicted 1778
5 SASI_Rn01_00114643 predicted 1555
6 SASI_Rn01_00114644 predicted 2570
7 SASI_Rn01_00114645 predicted 2586
8 SASI_Rn01_00114648 predicted 2476
9 SASI_Rn02_00200577 predicted 896
10 SASI_Rn02_00200578 predicted 1727
11 SASI_Rn01_00114646 predicted 3325
12 SASI_Rn01_00114647 predicted 3304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175537 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199765 predicted 2153
2 SASI_Mm01_00199766 predicted 821
3 SASI_Mm01_00199770 predicted 2199
4 SASI_Mm02_00346490 predicted 3780
5 SASI_Mm01_00199771 predicted 670
6 SASI_Mm02_00346491 predicted 3711
7 SASI_Mm01_00199772 predicted 529
8 SASI_Mm02_00346492 predicted 2998
9 SASI_Mm02_00346493 predicted 3022
10 SASI_Mm02_00346494 predicted 2187
11 SASI_Mm01_00199767 predicted 1870
12 SASI_Mm01_00199768 predicted 877
13 SASI_Mm01_00199769 predicted 944
14 SASI_Mm01_00199773 predicted 1038
15 SASI_Mm01_00199774 predicted 715
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175537
VALIDATED
ZBTB38 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 38
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175537.2-2756s1c1
Sequence:CCGGCGAGACAGATAAAGCCAGTAACTCGAGTTACTGGCTTTATCTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-1718s1c1
Sequence:CCGGCCACTATTGGTCAAGATGGAACTCGAGTTCCATCTTGACCAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175537.2-1874s1c1
Sequence:CCGGGCAAACGTAGTTATGTGACTTCTCGAGAAGTCACATAACTACGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-727s1c1
Sequence:CCGGGCCGAAGTGTTTACAGAAATACTCGAGTATTTCTGTAAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-1754s1c1
Sequence:CCGGCGGAATCATTAGGGCCAGAAACTCGAGTTTCTGGCCCTAATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175537
VALIDATED
ZBTB38 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 38
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175537.2-2756s1c1
Sequence:CCGGCGAGACAGATAAAGCCAGTAACTCGAGTTACTGGCTTTATCTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-1718s1c1
Sequence:CCGGCCACTATTGGTCAAGATGGAACTCGAGTTCCATCTTGACCAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175537.2-1874s1c1
Sequence:CCGGGCAAACGTAGTTATGTGACTTCTCGAGAAGTCACATAACTACGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-727s1c1
Sequence:CCGGGCCGAAGTGTTTACAGAAATACTCGAGTATTTCTGTAAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-1754s1c1
Sequence:CCGGCGGAATCATTAGGGCCAGAAACTCGAGTTTCTGGCCCTAATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175537
VALIDATED
ZBTB38 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 38
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175537.2-2756s1c1
Sequence:CCGGCGAGACAGATAAAGCCAGTAACTCGAGTTACTGGCTTTATCTGTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-1718s1c1
Sequence:CCGGCCACTATTGGTCAAGATGGAACTCGAGTTCCATCTTGACCAATAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175537.2-1874s1c1
Sequence:CCGGGCAAACGTAGTTATGTGACTTCTCGAGAAGTCACATAACTACGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-727s1c1
Sequence:CCGGGCCGAAGTGTTTACAGAAATACTCGAGTATTTCTGTAAACACTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175537.2-1754s1c1
Sequence:CCGGCGGAATCATTAGGGCCAGAAACTCGAGTTTCTGGCCCTAATGATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080412
VALIDATED
ZBTB38 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 38
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000237972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080412.2-8023s21c1
Sequence:CCGGAGCATTATAAGCTGGTAATTTCTCGAGAAATTACCAGCTTATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080412.2-4314s21c1
Sequence:CCGGATCACGAGCAGAGGCATATTCCTCGAGGAATATGCCTCTGCTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080412.2-2511s21c1
Sequence:CCGGATACGGGAGAAAGACGATATCCTCGAGGATATCGTCTTTCTCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080412.2-2654s21c1
Sequence:CCGGCCTAGTGTCTATCCGTATAAACTCGAGTTTATACGGATAGACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080412.2-1841s21c1
Sequence:CCGGGTATCCAACTTAGAGGTTAATCTCGAGATTAACCTCTAAGTTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080412
VALIDATED
ZBTB38 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 38
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000237972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080412.2-8023s21c1
Sequence:CCGGAGCATTATAAGCTGGTAATTTCTCGAGAAATTACCAGCTTATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080412.2-4314s21c1
Sequence:CCGGATCACGAGCAGAGGCATATTCCTCGAGGAATATGCCTCTGCTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080412.2-2511s21c1
Sequence:CCGGATACGGGAGAAAGACGATATCCTCGAGGATATCGTCTTTCTCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080412.2-2654s21c1
Sequence:CCGGCCTAGTGTCTATCCGTATAAACTCGAGTTTATACGGATAGACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080412.2-1841s21c1
Sequence:CCGGGTATCCAACTTAGAGGTTAATCTCGAGATTAACCTCTAAGTTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080412
VALIDATED
ZBTB38 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 38
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000237972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080412.2-8023s21c1
Sequence:CCGGAGCATTATAAGCTGGTAATTTCTCGAGAAATTACCAGCTTATAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080412.2-4314s21c1
Sequence:CCGGATCACGAGCAGAGGCATATTCCTCGAGGAATATGCCTCTGCTCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080412.2-2511s21c1
Sequence:CCGGATACGGGAGAAAGACGATATCCTCGAGGATATCGTCTTTCTCCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001080412.2-2654s21c1
Sequence:CCGGCCTAGTGTCTATCCGTATAAACTCGAGTTTATACGGATAGACACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080412.2-1841s21c1
Sequence:CCGGGTATCCAACTTAGAGGTTAATCTCGAGATTAACCTCTAAGTTGGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks