EMAIL THIS PAGE TO A FRIEND

ZBTB39

zinc finger and BTB domain containing 39

Synonyms: ZNF922
UniProtKB ID: O15060, A7MD38, Q9UD98
Gene ID:
Mouse(320080) zinc finger and BTB domain containing 39
Rat(299510) zinc finger and BTB domain containing 39
chicken(100858734) zinc finger and BTB domain containing 39
Horse(100049990) zinc finger and BTB domain containing 39
domestic cat(101089116) zinc finger and BTB domain containing 39
dog(481121) zinc finger and BTB domain containing 39
cow(510453) zinc finger and BTB domain containing 39
sheep(101103709) zinc finger and BTB domain containing 39
naked mole-rat(101697425) zinc finger and BTB domain containing 39
domestic guinea pig(100727707) zinc finger and BTB domain containing 39
155 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_374985 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_374985 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_374985 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014830 Rosetta Predictions human pricing
NM_001130537 Rosetta Predictions rat pricing
NM_198035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166078 predicted 2021
2 SASI_Hs01_00166079 predicted 910
3 SASI_Hs01_00166080 predicted 1233
4 SASI_Hs02_00346375 predicted 1453
5 SASI_Hs01_00166081 predicted 1984
6 SASI_Hs01_00166082 predicted 2082
7 SASI_Hs01_00166083 predicted 1626
8 SASI_Hs01_00166084 predicted 822
9 SASI_Hs01_00166085 predicted 1290
10 SASI_Hs01_00166086 predicted 834
11 SASI_Hs01_00166087 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255559 predicted 638
2 SASI_Rn02_00255560 predicted 2160
3 SASI_Rn02_00255561 predicted 2152
4 SASI_Rn02_00255562 predicted 545
5 SASI_Rn02_00255563 predicted 878
6 SASI_Rn02_00255564 predicted 1160
7 SASI_Rn02_00255565 predicted 1496
8 SASI_Rn02_00255566 predicted 944
9 SASI_Rn02_00255567 predicted 894
10 SASI_Rn02_00255568 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178159 predicted 952
2 SASI_Mm01_00178160 predicted 1516
3 SASI_Mm01_00178161 predicted 1017
4 SASI_Mm01_00178162 predicted 654
5 SASI_Mm02_00350789 predicted 943
6 SASI_Mm01_00178163 predicted 542
7 SASI_Mm01_00178164 predicted 2170
8 SASI_Mm01_00178165 predicted 893
9 SASI_Mm01_00178166 predicted 2181
10 SASI_Mm01_00178167 predicted 1314
11 SASI_Mm01_00178168 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198035
VALIDATED
ZBTB39 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 39
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198035.1-957s21c1
Sequence:CCGGCTGATAACGCGGTAGACATTACTCGAGTAATGTCTACCGCGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198035.1-2805s21c1
Sequence:CCGGACAGCTCAGATCGCCTGATTGCTCGAGCAATCAGGCGATCTGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198035.1-2465s21c1
Sequence:CCGGGCGGCACCGCTGTTACATTTACTCGAGTAAATGTAACAGCGGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198035.1-539s21c1
Sequence:CCGCGACCTAGAGAGCACTGCAATACTCGAGTATTGCAGTGCTCTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198035.1-2348s1c1
Sequence:CCGGGCCGGGATAGTGACTTTGTAACTCGAGTTACAAAGTCACTATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-1372s1c1
Sequence:CCGGCTGCGATATGTGTGAGACAAACTCGAGTTTGTCTCACACATATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-2248s1c1
Sequence:CCGGCGAGCAGACCTTCATGTACATCTCGAGATGTACATGAAGGTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198035.1-900s1c1
Sequence:CCGGGCCAGCCATACAAAGTTCAAACTCGAGTTTGAACTTTGTATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-2170s1c1
Sequence:CCGGCCACTACAGTTCCACCCTTAACTCGAGTTAAGGGTGGAACTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198035
VALIDATED
ZBTB39 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 39
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198035.1-957s21c1
Sequence:CCGGCTGATAACGCGGTAGACATTACTCGAGTAATGTCTACCGCGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198035.1-2805s21c1
Sequence:CCGGACAGCTCAGATCGCCTGATTGCTCGAGCAATCAGGCGATCTGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198035.1-2465s21c1
Sequence:CCGGGCGGCACCGCTGTTACATTTACTCGAGTAAATGTAACAGCGGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198035.1-539s21c1
Sequence:CCGCGACCTAGAGAGCACTGCAATACTCGAGTATTGCAGTGCTCTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198035.1-2348s1c1
Sequence:CCGGGCCGGGATAGTGACTTTGTAACTCGAGTTACAAAGTCACTATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-1372s1c1
Sequence:CCGGCTGCGATATGTGTGAGACAAACTCGAGTTTGTCTCACACATATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-2248s1c1
Sequence:CCGGCGAGCAGACCTTCATGTACATCTCGAGATGTACATGAAGGTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198035.1-900s1c1
Sequence:CCGGGCCAGCCATACAAAGTTCAAACTCGAGTTTGAACTTTGTATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-2170s1c1
Sequence:CCGGCCACTACAGTTCCACCCTTAACTCGAGTTAAGGGTGGAACTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198035
VALIDATED
ZBTB39 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 39
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198035.1-957s21c1
Sequence:CCGGCTGATAACGCGGTAGACATTACTCGAGTAATGTCTACCGCGTTATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198035.1-2805s21c1
Sequence:CCGGACAGCTCAGATCGCCTGATTGCTCGAGCAATCAGGCGATCTGAGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198035.1-2465s21c1
Sequence:CCGGGCGGCACCGCTGTTACATTTACTCGAGTAAATGTAACAGCGGTGCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198035.1-539s21c1
Sequence:CCGCGACCTAGAGAGCACTGCAATACTCGAGTATTGCAGTGCTCTCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085503    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198035.1-2348s1c1
Sequence:CCGGGCCGGGATAGTGACTTTGTAACTCGAGTTACAAAGTCACTATCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-1372s1c1
Sequence:CCGGCTGCGATATGTGTGAGACAAACTCGAGTTTGTCTCACACATATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-2248s1c1
Sequence:CCGGCGAGCAGACCTTCATGTACATCTCGAGATGTACATGAAGGTCTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198035.1-900s1c1
Sequence:CCGGGCCAGCCATACAAAGTTCAAACTCGAGTTTGAACTTTGTATGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198035.1-2170s1c1
Sequence:CCGGCCACTACAGTTCCACCCTTAACTCGAGTTAAGGGTGGAACTGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014830
VALIDATED
ZBTB39 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 39
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-615s21c1
Sequence:CCGGGATGCTGGAGGGAGCTATAAACTCGAGTTTATAGCTCCCTCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014830.1-5964s21c1
Sequence:CCGGCGTCTAACTCCTTCCATTAAACTCGAGTTTAATGGAAGGAGTTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-1258s21c1
Sequence:CCGGTCCTGTCCCACATTGGTATTTCTCGAGAAATACCAATGTGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014830.1-1493s21c1
Sequence:CCGGCCACATCCTTGACCATCTAAACTCGAGTTTAGATGGTCAAGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-1338s21c1
Sequence:CCGGCACCGACGGGATGGAATATTTCTCGAGAAATATTCCATCCCGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014830
VALIDATED
ZBTB39 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 39
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-615s21c1
Sequence:CCGGGATGCTGGAGGGAGCTATAAACTCGAGTTTATAGCTCCCTCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014830.1-5964s21c1
Sequence:CCGGCGTCTAACTCCTTCCATTAAACTCGAGTTTAATGGAAGGAGTTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-1258s21c1
Sequence:CCGGTCCTGTCCCACATTGGTATTTCTCGAGAAATACCAATGTGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014830.1-1493s21c1
Sequence:CCGGCCACATCCTTGACCATCTAAACTCGAGTTTAGATGGTCAAGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-1338s21c1
Sequence:CCGGCACCGACGGGATGGAATATTTCTCGAGAAATATTCCATCCCGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014830
VALIDATED
ZBTB39 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 39
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-615s21c1
Sequence:CCGGGATGCTGGAGGGAGCTATAAACTCGAGTTTATAGCTCCCTCCAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014830.1-5964s21c1
Sequence:CCGGCGTCTAACTCCTTCCATTAAACTCGAGTTTAATGGAAGGAGTTAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234756    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-1258s21c1
Sequence:CCGGTCCTGTCCCACATTGGTATTTCTCGAGAAATACCAATGTGGGACAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014830.1-1493s21c1
Sequence:CCGGCCACATCCTTGACCATCTAAACTCGAGTTTAGATGGTCAAGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_014830.1-1338s21c1
Sequence:CCGGCACCGACGGGATGGAATATTTCTCGAGAAATATTCCATCCCGTCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_374985
VALIDATED
ZBTB39 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 39
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000019735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374985.1-2122s1c1
Sequence:CCGGGCACTACAGTTCCACCCTTAACTCGAGTTAAGGGTGGAACTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374985.1-2020s1c1
Sequence:CCGGCCAATGTAAGGTGTGCCACAACTCGAGTTGTGGCACACCTTACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:XM_374985.1-1527s1c1
Sequence:CCGGGCCACATCCTTGACCATCTAACTCGAGTTAGATGGTCAAGGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_374985.1-1073s1c1
Sequence:CCGGGAGGTGATTGAGCTGAGTGATCTCGAGATCACTCAGCTCAATCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_374985
VALIDATED
ZBTB39 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 39
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000019735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374985.1-2122s1c1
Sequence:CCGGGCACTACAGTTCCACCCTTAACTCGAGTTAAGGGTGGAACTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374985.1-2020s1c1
Sequence:CCGGCCAATGTAAGGTGTGCCACAACTCGAGTTGTGGCACACCTTACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:XM_374985.1-1527s1c1
Sequence:CCGGGCCACATCCTTGACCATCTAACTCGAGTTAGATGGTCAAGGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_374985.1-1073s1c1
Sequence:CCGGGAGGTGATTGAGCTGAGTGATCTCGAGATCACTCAGCTCAATCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_374985
VALIDATED
ZBTB39 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 39
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000019735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374985.1-2122s1c1
Sequence:CCGGGCACTACAGTTCCACCCTTAACTCGAGTTAAGGGTGGAACTGTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_374985.1-2020s1c1
Sequence:CCGGCCAATGTAAGGTGTGCCACAACTCGAGTTGTGGCACACCTTACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:XM_374985.1-1527s1c1
Sequence:CCGGGCCACATCCTTGACCATCTAACTCGAGTTAGATGGTCAAGGATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:XM_374985.1-1073s1c1
Sequence:CCGGGAGGTGATTGAGCTGAGTGATCTCGAGATCACTCAGCTCAATCACCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks