EMAIL THIS PAGE TO A FRIEND

ZBTB3

zinc finger and BTB domain containing 3

UniProtKB ID: Q9H5J0
Gene ID:
Mouse(75291) zinc finger and BTB domain containing 3
Rat(499313) zinc finger and BTB domain containing 3
Zebrafish(100003975) zinc finger and BTB domain containing 3
Horse(100060251) zinc finger and BTB domain containing 3
dog(483781) zinc finger and BTB domain containing 3
domestic cat(101087943) zinc finger and BTB domain containing 3
cow(508118) zinc finger and BTB domain containing 3
sheep(101112272) zinc finger and BTB domain containing 3
naked mole-rat(101697146) zinc finger and BTB domain containing 3
Domestic Rabbit(100347853) zinc finger and BTB domain containing 3
domestic guinea pig(100733681) zinc finger and BTB domain containing 3
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024784 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133759 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133759 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133759 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024784 Rosetta Predictions human pricing
NM_001109162 Rosetta Predictions rat pricing
NM_001098237 Rosetta Predictions mouse pricing
NM_133759 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182302 predicted 1332
2 SASI_Hs01_00182303 predicted 1556
3 SASI_Hs01_00182304 predicted 326
4 SASI_Hs01_00182305 predicted 1508
5 SASI_Hs02_00357324 predicted 461
6 SASI_Hs01_00182307 predicted 1427
7 SASI_Hs01_00182308 predicted 1582
8 SASI_Hs02_00357325 predicted 640
9 SASI_Hs01_00182310 predicted 446
10 SASI_Hs02_00357326 predicted 1430
11 SASI_Hs01_00182306 predicted 1673
12 SASI_Hs01_00182309 predicted 534
13 SASI_Hs01_00182311 predicted 1490
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245740 predicted 1463
2 SASI_Rn02_00245741 predicted 1379
3 SASI_Rn02_00245742 predicted 469
4 SASI_Rn02_00245743 predicted 499
5 SASI_Rn02_00245744 predicted 650
6 SASI_Rn02_00245745 predicted 1540
7 SASI_Rn02_00245746 predicted 1104
8 SASI_Rn02_00245747 predicted 800
9 SASI_Rn02_00245748 predicted 1546
10 SASI_Rn02_00245749 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301337 predicted 509
2 SASI_Mm02_00301338 predicted 1775
3 SASI_Mm02_00301339 predicted 694
4 SASI_Mm02_00301340 predicted 1447
5 SASI_Mm02_00301341 predicted 477
6 SASI_Mm02_00301342 predicted 1731
7 SASI_Mm02_00301343 predicted 1288
8 SASI_Mm02_00301344 predicted 609
9 SASI_Mm02_00301345 predicted 1525
10 SASI_Mm02_00301346 predicted 1548
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040994 predicted 390
2 SASI_Mm02_00338756 predicted 1657
3 SASI_Mm01_00040996 predicted 575
4 SASI_Mm01_00040997 predicted 1332
5 SASI_Mm01_00040998 predicted 354
6 SASI_Mm01_00040999 predicted 1611
7 SASI_Mm01_00041000 predicted 1172
8 SASI_Mm01_00041001 predicted 485
9 SASI_Mm01_00041002 predicted 1403
10 SASI_Mm01_00041003 predicted 1432
11 SASI_Mm01_00040995 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024784
ZBTB3 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1149s1c1
Sequence:CCGGGAAGCTATTGTGATCTCTGATCTCGAGATCAGAGATCACAATAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-548s1c1
Sequence:CCGGGCACATGAATGACATCGTCAACTCGAGTTGACGATGTCATTCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1136s1c1
Sequence:CCGGCCAGGTGAAAGTTGAAGCTATCTCGAGATAGCTTCAACTTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-637s1c1
Sequence:CCGGCCAACTCACAGCTTCCTAGTTCTCGAGAACTAGGAAGCTGTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1530s1c1
Sequence:CCGGTCTTACACACTACGGCGACATCTCGAGATGTCGCCGTAGTGTGTAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1457s21c1
Sequence:CCGGATCCCTGCATGAGCCACTTTACTCGAGTAAAGTGGCTCATGCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1069s21c1
Sequence:CCGGGACCACTGCAAGGCTTCTATCCTCGAGGATAGAAGCCTTGCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1675s21c1
Sequence:CCGGACATCCGCAAGGCTCACAATGCTCGAGCATTGTGAGCCTTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024784
ZBTB3 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1149s1c1
Sequence:CCGGGAAGCTATTGTGATCTCTGATCTCGAGATCAGAGATCACAATAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-548s1c1
Sequence:CCGGGCACATGAATGACATCGTCAACTCGAGTTGACGATGTCATTCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1136s1c1
Sequence:CCGGCCAGGTGAAAGTTGAAGCTATCTCGAGATAGCTTCAACTTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-637s1c1
Sequence:CCGGCCAACTCACAGCTTCCTAGTTCTCGAGAACTAGGAAGCTGTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1530s1c1
Sequence:CCGGTCTTACACACTACGGCGACATCTCGAGATGTCGCCGTAGTGTGTAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1457s21c1
Sequence:CCGGATCCCTGCATGAGCCACTTTACTCGAGTAAAGTGGCTCATGCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1069s21c1
Sequence:CCGGGACCACTGCAAGGCTTCTATCCTCGAGGATAGAAGCCTTGCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1675s21c1
Sequence:CCGGACATCCGCAAGGCTCACAATGCTCGAGCATTGTGAGCCTTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024784
ZBTB3 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1149s1c1
Sequence:CCGGGAAGCTATTGTGATCTCTGATCTCGAGATCAGAGATCACAATAGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-548s1c1
Sequence:CCGGGCACATGAATGACATCGTCAACTCGAGTTGACGATGTCATTCATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1136s1c1
Sequence:CCGGCCAGGTGAAAGTTGAAGCTATCTCGAGATAGCTTCAACTTTCACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-637s1c1
Sequence:CCGGCCAACTCACAGCTTCCTAGTTCTCGAGAACTAGGAAGCTGTGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024784.2-1530s1c1
Sequence:CCGGTCTTACACACTACGGCGACATCTCGAGATGTCGCCGTAGTGTGTAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1457s21c1
Sequence:CCGGATCCCTGCATGAGCCACTTTACTCGAGTAAAGTGGCTCATGCAGGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1069s21c1
Sequence:CCGGGACCACTGCAAGGCTTCTATCCTCGAGGATAGAAGCCTTGCAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024784.3-1675s21c1
Sequence:CCGGACATCCGCAAGGCTCACAATGCTCGAGCATTGTGAGCCTTGCGGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133759
ZBTB3 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133759.1-1660s1c1
Sequence:CCGGCTGCTCTTACCATTGCTAGATCTCGAGATCTAGCAATGGTAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-150s1c1
Sequence:CCGGGCACTGTGATGGTTGGTAGTACTCGAGTACTACCAACCATCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-1595s1c1
Sequence:CCGGCCACCCAAAGAATTTGCACTTCTCGAGAAGTGCAAATTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-1557s1c1
Sequence:CCGGCCCAAACGACAGAGAGACATACTCGAGTATGTCTCTCTGTCGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-391s1c1
Sequence:CCGGGCACATGAATGACATTGTTAACTCGAGTTAACAATGTCATTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-401s21c1
Sequence:CCGGACTTGCACATGAATGACATTGCTCGAGCAATGTCATTCATGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133759.3-1732s21c1
Sequence:CCGGGGTGGCAGAATGAAGGTTCTTCTCGAGAAGAACCTTCATTCTGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-1618s21c1
Sequence:CCGGGAATTTGCACTTGGTCCTAAACTCGAGTTTAGGACCAAGTGCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-241s21c1
Sequence:CCGGTTCTACAAGGAGCGGGAATTGCTCGAGCAATTCCCGCTCCTTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-884s21c1
Sequence:CCGGGACCATTGCAAGGCTTCTATCCTCGAGGATAGAAGCCTTGCAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133759
ZBTB3 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133759.1-1660s1c1
Sequence:CCGGCTGCTCTTACCATTGCTAGATCTCGAGATCTAGCAATGGTAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-150s1c1
Sequence:CCGGGCACTGTGATGGTTGGTAGTACTCGAGTACTACCAACCATCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-1595s1c1
Sequence:CCGGCCACCCAAAGAATTTGCACTTCTCGAGAAGTGCAAATTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-1557s1c1
Sequence:CCGGCCCAAACGACAGAGAGACATACTCGAGTATGTCTCTCTGTCGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-391s1c1
Sequence:CCGGGCACATGAATGACATTGTTAACTCGAGTTAACAATGTCATTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-401s21c1
Sequence:CCGGACTTGCACATGAATGACATTGCTCGAGCAATGTCATTCATGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133759.3-1732s21c1
Sequence:CCGGGGTGGCAGAATGAAGGTTCTTCTCGAGAAGAACCTTCATTCTGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-1618s21c1
Sequence:CCGGGAATTTGCACTTGGTCCTAAACTCGAGTTTAGGACCAAGTGCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-241s21c1
Sequence:CCGGTTCTACAAGGAGCGGGAATTGCTCGAGCAATTCCCGCTCCTTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-884s21c1
Sequence:CCGGGACCATTGCAAGGCTTCTATCCTCGAGGATAGAAGCCTTGCAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133759
ZBTB3 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133759.1-1660s1c1
Sequence:CCGGCTGCTCTTACCATTGCTAGATCTCGAGATCTAGCAATGGTAAGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-150s1c1
Sequence:CCGGGCACTGTGATGGTTGGTAGTACTCGAGTACTACCAACCATCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-1595s1c1
Sequence:CCGGCCACCCAAAGAATTTGCACTTCTCGAGAAGTGCAAATTCTTTGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-1557s1c1
Sequence:CCGGCCCAAACGACAGAGAGACATACTCGAGTATGTCTCTCTGTCGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133759.1-391s1c1
Sequence:CCGGGCACATGAATGACATTGTTAACTCGAGTTAACAATGTCATTCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-401s21c1
Sequence:CCGGACTTGCACATGAATGACATTGCTCGAGCAATGTCATTCATGTGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321541    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133759.3-1732s21c1
Sequence:CCGGGGTGGCAGAATGAAGGTTCTTCTCGAGAAGAACCTTCATTCTGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-1618s21c1
Sequence:CCGGGAATTTGCACTTGGTCCTAAACTCGAGTTTAGGACCAAGTGCAAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-241s21c1
Sequence:CCGGTTCTACAAGGAGCGGGAATTGCTCGAGCAATTCCCGCTCCTTGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133759.3-884s21c1
Sequence:CCGGGACCATTGCAAGGCTTCTATCCTCGAGGATAGAAGCCTTGCAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks