EMAIL THIS PAGE TO A FRIEND

ZBTB40

zinc finger and BTB domain containing 40

Synonyms: ZNF923
UniProtKB ID: Q9NUA8, O75066, Q5TFU5, Q8N1R1
Gene ID:
Mouse(230848) zinc finger and BTB domain containing 40
Rat(362635) zinc finger and BTB domain containing 40
Zebrafish(572136) zinc finger and BTB domain containing 40
Horse(100058142) zinc finger and BTB domain containing 40
domestic cat(101095426) zinc finger and BTB domain containing 40
dog(487384) zinc finger and BTB domain containing 40
chicken(419505) zinc finger and BTB domain containing 40
cow(534714) zinc finger and BTB domain containing 40
sheep(101102545) zinc finger and BTB domain containing 40
Domestic Rabbit(100347585) zinc finger and BTB domain containing 40
naked mole-rat(101702320) zinc finger and BTB domain containing 40
domestic guinea pig(100716645) zinc finger and BTB domain containing 40
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014870 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014870 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014870 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198248 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198248 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198248 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053121 MISSION® esiRNA esiRNA human ZBTB40 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083621 Rosetta Predictions human pricing
NM_014870 Rosetta Predictions human pricing
XM_001070250 Rosetta Predictions rat pricing
XM_342953 Rosetta Predictions rat pricing
NM_198248 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317181 predicted 1686
2 SASI_Hs02_00317182 predicted 2210
3 SASI_Hs02_00317183 predicted 1380
4 SASI_Hs02_00317184 predicted 1614
5 SASI_Hs02_00317185 predicted 1900
6 SASI_Hs02_00317186 predicted 2227
7 SASI_Hs02_00317187 predicted 1123
8 SASI_Hs02_00317188 predicted 835
9 SASI_Hs02_00317189 predicted 2716
10 SASI_Hs02_00317190 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205955 predicted 1398
2 SASI_Hs01_00205956 predicted 1926
3 SASI_Hs01_00205957 predicted 1101
4 SASI_Hs02_00346471 predicted 1325
5 SASI_Hs01_00205958 predicted 1611
6 SASI_Hs01_00205960 predicted 1946
7 SASI_Hs01_00205961 predicted 832
8 SASI_Hs01_00205962 predicted 547
9 SASI_Hs01_00205963 predicted 2433
10 SASI_Hs02_00346472 predicted 566
11 SASI_Hs01_00205954 predicted 2507
12 SASI_Hs01_00205959 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070250 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331001 predicted 1065
2 SASI_Rn02_00331002 predicted 998
3 SASI_Rn02_00331003 predicted 3257
4 SASI_Rn02_00331004 predicted 3324
5 SASI_Rn02_00331005 predicted 412
6 SASI_Rn02_00331006 predicted 2271
7 SASI_Rn02_00331007 predicted 1172
8 SASI_Rn02_00331008 predicted 1053
9 SASI_Rn02_00331009 predicted 2883
10 SASI_Rn02_00331010 predicted 802
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395121 predicted 1065
2 SASI_Rn02_00395122 predicted 253
3 SASI_Rn02_00395123 predicted 959
4 SASI_Rn02_00395124 predicted 998
5 SASI_Rn02_00395125 predicted 416
6 SASI_Rn02_00395126 predicted 2274
7 SASI_Rn02_00395127 predicted 1165
8 SASI_Rn02_00395128 predicted 1048
9 SASI_Rn02_00395129 predicted 796
10 SASI_Rn02_00395130 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198248 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155467 predicted 1171
2 SASI_Mm01_00155468 predicted 625
3 SASI_Mm01_00155469 predicted 1784
4 SASI_Mm01_00155470 predicted 3528
5 SASI_Mm01_00155471 predicted 1062
6 SASI_Mm01_00155472 predicted 912
7 SASI_Mm01_00155473 predicted 3356
8 SASI_Mm02_00350898 predicted 1457
9 SASI_Mm01_00155474 predicted 3822
10 SASI_Mm01_00155475 predicted 762
11 SASI_Mm01_00155476 predicted 327
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014870
ZBTB40 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 40
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014870.3-5941s21c1
Sequence:CCGGATAATTGCTGAGGGCTTATAGCTCGAGCTATAAGCCCTCAGCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-1319s21c1
Sequence:CCGGACACAGCTGAGACCTATTATGCTCGAGCATAATAGGTCTCAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-2258s21c1
Sequence:CCGGACGTGGAAGGTGAGTAATAAACTCGAGTTTATTACTCACCTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-3302s21c1
Sequence:CCGGACCCACCACCCTGACGTATTTCTCGAGAAATACGTCAGGGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-1159s21c1
Sequence:CCGGGTTGAGGCTGTACCAATATTCCTCGAGGAATATTGGTACAGCCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-3534s1c1
Sequence:CCGGGCTTGTACTGTGCTGCTACTTCTCGAGAAGTAGCAGCACAGTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-506s1c1
Sequence:CCGGGCAGACAGTCTACAGATGTTTCTCGAGAAACATCTGTAGACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014870.2-4742s1c1
Sequence:CCGGCCTTTAATCAAAGGCTGAAATCTCGAGATTTCAGCCTTTGATTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-2452s1c1
Sequence:CCGGCCATTTCTACTGCCGCCTAAACTCGAGTTTAGGCGGCAGTAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-874s1c1
Sequence:CCGGGCAAACCTTTAGTGAGGCAAACTCGAGTTTGCCTCACTAAAGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014870
ZBTB40 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 40
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014870.3-5941s21c1
Sequence:CCGGATAATTGCTGAGGGCTTATAGCTCGAGCTATAAGCCCTCAGCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-1319s21c1
Sequence:CCGGACACAGCTGAGACCTATTATGCTCGAGCATAATAGGTCTCAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-2258s21c1
Sequence:CCGGACGTGGAAGGTGAGTAATAAACTCGAGTTTATTACTCACCTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-3302s21c1
Sequence:CCGGACCCACCACCCTGACGTATTTCTCGAGAAATACGTCAGGGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-1159s21c1
Sequence:CCGGGTTGAGGCTGTACCAATATTCCTCGAGGAATATTGGTACAGCCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-3534s1c1
Sequence:CCGGGCTTGTACTGTGCTGCTACTTCTCGAGAAGTAGCAGCACAGTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-506s1c1
Sequence:CCGGGCAGACAGTCTACAGATGTTTCTCGAGAAACATCTGTAGACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014870.2-4742s1c1
Sequence:CCGGCCTTTAATCAAAGGCTGAAATCTCGAGATTTCAGCCTTTGATTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-2452s1c1
Sequence:CCGGCCATTTCTACTGCCGCCTAAACTCGAGTTTAGGCGGCAGTAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-874s1c1
Sequence:CCGGGCAAACCTTTAGTGAGGCAAACTCGAGTTTGCCTCACTAAAGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014870
ZBTB40 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 40
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014870.3-5941s21c1
Sequence:CCGGATAATTGCTGAGGGCTTATAGCTCGAGCTATAAGCCCTCAGCAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-1319s21c1
Sequence:CCGGACACAGCTGAGACCTATTATGCTCGAGCATAATAGGTCTCAGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-2258s21c1
Sequence:CCGGACGTGGAAGGTGAGTAATAAACTCGAGTTTATTACTCACCTTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-3302s21c1
Sequence:CCGGACCCACCACCCTGACGTATTTCTCGAGAAATACGTCAGGGTGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014870.3-1159s21c1
Sequence:CCGGGTTGAGGCTGTACCAATATTCCTCGAGGAATATTGGTACAGCCTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-3534s1c1
Sequence:CCGGGCTTGTACTGTGCTGCTACTTCTCGAGAAGTAGCAGCACAGTACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-506s1c1
Sequence:CCGGGCAGACAGTCTACAGATGTTTCTCGAGAAACATCTGTAGACTGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013533    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014870.2-4742s1c1
Sequence:CCGGCCTTTAATCAAAGGCTGAAATCTCGAGATTTCAGCCTTTGATTAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-2452s1c1
Sequence:CCGGCCATTTCTACTGCCGCCTAAACTCGAGTTTAGGCGGCAGTAGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014870.2-874s1c1
Sequence:CCGGGCAAACCTTTAGTGAGGCAAACTCGAGTTTGCCTCACTAAAGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198248
ZBTB40 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 40
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000455146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198248.1-470s21c1
Sequence:CCGGGTGGTAAGAGATGTCTCAGTGCTCGAGCACTGAGACATCTCTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198248.1-6141s1c1
Sequence:CCGGCCCTTGGAATTTGTGTATTTACTCGAGTAAATACACAAATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-916s1c1
Sequence:CCGGGCCTCAGAAGGAGACCATAATCTCGAGATTATGGTCTCCTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-161s1c1
Sequence:CCGGCGGTTCTGTGATTGCACCATTCTCGAGAATGGTGCAATCACAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-2386s1c1
Sequence:CCGGCCATTTCTACTGCCGTCTGAACTCGAGTTCAGACGGCAGTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-3832s1c1
Sequence:CCGGGCTGGATGGTACTGTCACATTCTCGAGAATGTGACAGTACCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198248
ZBTB40 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 40
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000455146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198248.1-470s21c1
Sequence:CCGGGTGGTAAGAGATGTCTCAGTGCTCGAGCACTGAGACATCTCTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198248.1-6141s1c1
Sequence:CCGGCCCTTGGAATTTGTGTATTTACTCGAGTAAATACACAAATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-916s1c1
Sequence:CCGGGCCTCAGAAGGAGACCATAATCTCGAGATTATGGTCTCCTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-161s1c1
Sequence:CCGGCGGTTCTGTGATTGCACCATTCTCGAGAATGGTGCAATCACAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-2386s1c1
Sequence:CCGGCCATTTCTACTGCCGTCTGAACTCGAGTTCAGACGGCAGTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-3832s1c1
Sequence:CCGGGCTGGATGGTACTGTCACATTCTCGAGAATGTGACAGTACCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198248
ZBTB40 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 40
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000455146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198248.1-470s21c1
Sequence:CCGGGTGGTAAGAGATGTCTCAGTGCTCGAGCACTGAGACATCTCTTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124799    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198248.1-6141s1c1
Sequence:CCGGCCCTTGGAATTTGTGTATTTACTCGAGTAAATACACAAATTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-916s1c1
Sequence:CCGGGCCTCAGAAGGAGACCATAATCTCGAGATTATGGTCTCCTTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-161s1c1
Sequence:CCGGCGGTTCTGTGATTGCACCATTCTCGAGAATGGTGCAATCACAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-2386s1c1
Sequence:CCGGCCATTTCTACTGCCGTCTGAACTCGAGTTCAGACGGCAGTAGAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198248.1-3832s1c1
Sequence:CCGGGCTGGATGGTACTGTCACATTCTCGAGAATGTGACAGTACCATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks