EMAIL THIS PAGE TO A FRIEND

ZBTB41

zinc finger and BTB domain containing 41

Synonyms: FRBZ1 RP11-469L3.1 ZNF924
UniProtKB ID: Q5SVQ8, A2RUA8, Q6MZT8, Q6ZR25, Q7Z4T1, Q8IZ99
Gene ID:
Mouse(226470) zinc finger and BTB domain containing 41 homolog
Rat(289052) zinc finger and BTB domain containing 41
chicken(424353) zinc finger and BTB domain containing 41
Horse(100051497) zinc finger and BTB domain containing 41
domestic cat(101092079) zinc finger and BTB domain containing 41
dog(612864) zinc finger and BTB domain containing 41
domestic guinea pig(100732771) zinc finger and BTB domain containing 41
naked mole-rat(101714238) zinc finger and BTB domain containing 41
cow(538902) zinc finger and BTB domain containing 41
sheep(101123481) zinc finger and BTB domain containing 41
307 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194314 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194314 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194314 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172643 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172643 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172643 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194314 Rosetta Predictions human pricing
XM_001067122 Rosetta Predictions rat pricing
XM_222679 Rosetta Predictions rat pricing
NM_172643 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194314 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082650 predicted 581
2 SASI_Hs01_00082651 predicted 1852
3 SASI_Hs01_00082652 predicted 2775
4 SASI_Hs01_00082653 predicted 1367
5 SASI_Hs01_00082654 predicted 1250
6 SASI_Hs02_00371453 predicted 2359
7 SASI_Hs01_00082655 predicted 1360
8 SASI_Hs01_00082656 predicted 447
9 SASI_Hs02_00371454 predicted 1291
10 SASI_Hs01_00082657 predicted 653
11 SASI_Hs01_00082649 predicted 2792
12 SASI_Hs01_00082658 predicted 2000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067122 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319921 predicted 1366
2 SASI_Rn02_00319922 predicted 1909
3 SASI_Rn02_00319923 predicted 612
4 SASI_Rn02_00319924 predicted 2550
5 SASI_Rn02_00319925 predicted 1368
6 SASI_Rn02_00319926 predicted 389
7 SASI_Rn02_00319927 predicted 970
8 SASI_Rn02_00319928 predicted 1472
9 SASI_Rn02_00319929 predicted 2416
10 SASI_Rn02_00319930 predicted 2202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380855 predicted 1368
2 SASI_Rn02_00380856 predicted 1906
3 SASI_Rn02_00380857 predicted 610
4 SASI_Rn02_00380858 predicted 2542
5 SASI_Rn02_00380859 predicted 1369
6 SASI_Rn02_00380860 predicted 384
7 SASI_Rn02_00380861 predicted 968
8 SASI_Rn02_00380862 predicted 1473
9 SASI_Rn02_00380863 predicted 2413
10 SASI_Rn02_00380864 predicted 2202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172643 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344346 predicted 611
2 SASI_Mm01_00059377 predicted 1414
3 SASI_Mm02_00344347 predicted 439
4 SASI_Mm01_00059378 predicted 1590
5 SASI_Mm02_00344348 predicted 547
6 SASI_Mm02_00344349 predicted 818
7 SASI_Mm01_00059380 predicted 2808
8 SASI_Mm01_00059381 predicted 1525
9 SASI_Mm01_00059382 predicted 2355
10 SASI_Mm02_00344350 predicted 1392
11 SASI_Mm01_00059374 predicted 2708
12 SASI_Mm01_00059375 predicted 1338
13 SASI_Mm01_00059376 predicted 1632
14 SASI_Mm01_00059379 predicted 2260
15 SASI_Mm01_00059383 predicted 2575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194314
VALIDATED
ZBTB41 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 41
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-1472s1c1
Sequence:CCGGGACCACACTTGGAGGAACATACTCGAGTATGTTCCTCCAAGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1360s1c1
Sequence:CCGGGCCAAGCATGTTAAGAGATTTCTCGAGAAATCTCTTAACATGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-871s1c1
Sequence:CCGGGATGGGTCAGACAATTTGAATCTCGAGATTCAAATTGTCTGACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194314.1-1561s1c1
Sequence:CCGGGCTCGGTTAAAGCATCAAGAACTCGAGTTCTTGATGCTTTAACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-82s1c1
Sequence:CCGGGAGAAGATCCATCTAGGCTATCTCGAGATAGCCTAGATGGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1236s1c1
Sequence:CCGGGCGCTATTCAACAAAGTCTAACTCGAGTTAGACTTTGTTGAATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1131s1c1
Sequence:CCGGGCAGTGTCCTAAATGTGATAACTCGAGTTATCACATTTAGGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-1822s1c1
Sequence:CCGGCTTCACTTACGAGTACATCATCTCGAGATGATGTACTCGTAAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1887s1c1
Sequence:CCGGCCGTCATGATCACCTTACAAACTCGAGTTTGTAAGGTGATCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-387s21c1
Sequence:CCGGTGCTGTCGGCAGTAGTTATTTCTCGAGAAATAACTACTGCCGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194314.2-2611s21c1
Sequence:CCGGTATCCACGAGCAGCGGATTTACTCGAGTAAATCCGCTGCTCGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-1572s21c1
Sequence:CCGGATCACGGTTTGCTCGGTTAAACTCGAGTTTAACCGAGCAAACCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-2707s21c1
Sequence:CCGGGATCCTAGAGAACAATCTTATCTCGAGATAAGATTGTTCTCTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-5433s21c1
Sequence:CCGGCTAATCTGCTGCCTCTAATTTCTCGAGAAATTAGAGGCAGCAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194314
VALIDATED
ZBTB41 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 41
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-1472s1c1
Sequence:CCGGGACCACACTTGGAGGAACATACTCGAGTATGTTCCTCCAAGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1360s1c1
Sequence:CCGGGCCAAGCATGTTAAGAGATTTCTCGAGAAATCTCTTAACATGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-871s1c1
Sequence:CCGGGATGGGTCAGACAATTTGAATCTCGAGATTCAAATTGTCTGACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194314.1-1561s1c1
Sequence:CCGGGCTCGGTTAAAGCATCAAGAACTCGAGTTCTTGATGCTTTAACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-82s1c1
Sequence:CCGGGAGAAGATCCATCTAGGCTATCTCGAGATAGCCTAGATGGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1236s1c1
Sequence:CCGGGCGCTATTCAACAAAGTCTAACTCGAGTTAGACTTTGTTGAATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1131s1c1
Sequence:CCGGGCAGTGTCCTAAATGTGATAACTCGAGTTATCACATTTAGGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-1822s1c1
Sequence:CCGGCTTCACTTACGAGTACATCATCTCGAGATGATGTACTCGTAAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1887s1c1
Sequence:CCGGCCGTCATGATCACCTTACAAACTCGAGTTTGTAAGGTGATCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-387s21c1
Sequence:CCGGTGCTGTCGGCAGTAGTTATTTCTCGAGAAATAACTACTGCCGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194314.2-2611s21c1
Sequence:CCGGTATCCACGAGCAGCGGATTTACTCGAGTAAATCCGCTGCTCGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-1572s21c1
Sequence:CCGGATCACGGTTTGCTCGGTTAAACTCGAGTTTAACCGAGCAAACCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-2707s21c1
Sequence:CCGGGATCCTAGAGAACAATCTTATCTCGAGATAAGATTGTTCTCTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-5433s21c1
Sequence:CCGGCTAATCTGCTGCCTCTAATTTCTCGAGAAATTAGAGGCAGCAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194314
VALIDATED
ZBTB41 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 41
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-1472s1c1
Sequence:CCGGGACCACACTTGGAGGAACATACTCGAGTATGTTCCTCCAAGTGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1360s1c1
Sequence:CCGGGCCAAGCATGTTAAGAGATTTCTCGAGAAATCTCTTAACATGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-871s1c1
Sequence:CCGGGATGGGTCAGACAATTTGAATCTCGAGATTCAAATTGTCTGACCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194314.1-1561s1c1
Sequence:CCGGGCTCGGTTAAAGCATCAAGAACTCGAGTTCTTGATGCTTTAACCGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-82s1c1
Sequence:CCGGGAGAAGATCCATCTAGGCTATCTCGAGATAGCCTAGATGGATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1236s1c1
Sequence:CCGGGCGCTATTCAACAAAGTCTAACTCGAGTTAGACTTTGTTGAATAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1131s1c1
Sequence:CCGGGCAGTGTCCTAAATGTGATAACTCGAGTTATCACATTTAGGACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_194314.1-1822s1c1
Sequence:CCGGCTTCACTTACGAGTACATCATCTCGAGATGATGTACTCGTAAGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_194314.1-1887s1c1
Sequence:CCGGCCGTCATGATCACCTTACAAACTCGAGTTTGTAAGGTGATCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-387s21c1
Sequence:CCGGTGCTGTCGGCAGTAGTTATTTCTCGAGAAATAACTACTGCCGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194314.2-2611s21c1
Sequence:CCGGTATCCACGAGCAGCGGATTTACTCGAGTAAATCCGCTGCTCGTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-1572s21c1
Sequence:CCGGATCACGGTTTGCTCGGTTAAACTCGAGTTTAACCGAGCAAACCGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-2707s21c1
Sequence:CCGGGATCCTAGAGAACAATCTTATCTCGAGATAAGATTGTTCTCTAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_194314.2-5433s21c1
Sequence:CCGGCTAATCTGCTGCCTCTAATTTCTCGAGAAATTAGAGGCAGCAGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172643
ZBTB41 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 41
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172643.1-3234s1c1
Sequence:CCGGCCTCAATTTGTGATAGACTTTCTCGAGAAAGTCTATCACAAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.1-1943s1c1
Sequence:CCGGCATCACGATGACAAGAGATATCTCGAGATATCTCTTGTCATCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.1-1000s1c1
Sequence:CCGGGCATCAAGAAAGTTCTGAGAACTCGAGTTCTCAGAACTTTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.5-2334s1c1
Sequence:CCGGCAACATTGCAATGCAACATTTCTCGAGAAATGTTGCATTGCAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.5-200s1c1
Sequence:CCGGGATCCATCTAGGCTATCATAACTCGAGTTATGATAGCCTAGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-411s21c1
Sequence:CCGGCAACCGTCTTTCTGCGATTTACTCGAGTAAATCGCAGAAAGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-1348s21c1
Sequence:CCGGATTCGACAAAGTCTAACTTAACTCGAGTTAAGTTAGACTTTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-479s21c1
Sequence:CCGGTGCTGTCGGCAGTAGTTATTTCTCGAGAAATAACTACTGCCGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172643.5-6209s21c1
Sequence:CCGGTAGATCAAATCGAGGTTATTTCTCGAGAAATAACCTCGATTTGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-1658s21c1
Sequence:CCGGATCCCGGTTTGCACGGTTAAACTCGAGTTTAACCGTGCAAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172643
ZBTB41 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 41
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172643.1-3234s1c1
Sequence:CCGGCCTCAATTTGTGATAGACTTTCTCGAGAAAGTCTATCACAAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.1-1943s1c1
Sequence:CCGGCATCACGATGACAAGAGATATCTCGAGATATCTCTTGTCATCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.1-1000s1c1
Sequence:CCGGGCATCAAGAAAGTTCTGAGAACTCGAGTTCTCAGAACTTTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.5-2334s1c1
Sequence:CCGGCAACATTGCAATGCAACATTTCTCGAGAAATGTTGCATTGCAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.5-200s1c1
Sequence:CCGGGATCCATCTAGGCTATCATAACTCGAGTTATGATAGCCTAGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-411s21c1
Sequence:CCGGCAACCGTCTTTCTGCGATTTACTCGAGTAAATCGCAGAAAGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-1348s21c1
Sequence:CCGGATTCGACAAAGTCTAACTTAACTCGAGTTAAGTTAGACTTTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-479s21c1
Sequence:CCGGTGCTGTCGGCAGTAGTTATTTCTCGAGAAATAACTACTGCCGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172643.5-6209s21c1
Sequence:CCGGTAGATCAAATCGAGGTTATTTCTCGAGAAATAACCTCGATTTGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-1658s21c1
Sequence:CCGGATCCCGGTTTGCACGGTTAAACTCGAGTTTAACCGTGCAAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172643
ZBTB41 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 41
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183061    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172643.1-3234s1c1
Sequence:CCGGCCTCAATTTGTGATAGACTTTCTCGAGAAAGTCTATCACAAATTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.1-1943s1c1
Sequence:CCGGCATCACGATGACAAGAGATATCTCGAGATATCTCTTGTCATCGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179637    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.1-1000s1c1
Sequence:CCGGGCATCAAGAAAGTTCTGAGAACTCGAGTTCTCAGAACTTTCTTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.5-2334s1c1
Sequence:CCGGCAACATTGCAATGCAACATTTCTCGAGAAATGTTGCATTGCAATGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216816    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172643.5-200s1c1
Sequence:CCGGGATCCATCTAGGCTATCATAACTCGAGTTATGATAGCCTAGATGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-411s21c1
Sequence:CCGGCAACCGTCTTTCTGCGATTTACTCGAGTAAATCGCAGAAAGACGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-1348s21c1
Sequence:CCGGATTCGACAAAGTCTAACTTAACTCGAGTTAAGTTAGACTTTGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-479s21c1
Sequence:CCGGTGCTGTCGGCAGTAGTTATTTCTCGAGAAATAACTACTGCCGACAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172643.5-6209s21c1
Sequence:CCGGTAGATCAAATCGAGGTTATTTCTCGAGAAATAACCTCGATTTGATCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241767    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172643.5-1658s21c1
Sequence:CCGGATCCCGGTTTGCACGGTTAAACTCGAGTTTAACCGTGCAAACCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks