EMAIL THIS PAGE TO A FRIEND

ZBTB42

zinc finger and BTB domain containing 42

Synonyms: ZNF925
UniProtKB ID: B2RXF5, B7ZW21
Gene ID:
Mouse(382639) zinc finger and BTB domain containing 42
Rat(691556) zinc finger and BTB domain containing 42
cow(789062) zinc finger and BTB domain containing 42
naked mole-rat(101700333) zinc finger and BTB domain containing 42
domestic guinea pig(100724995) zinc finger and BTB domain containing 42
chicken(428913) zinc finger and BTB domain containing 42
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_001477883 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001477883 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001477883 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001137601 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001137601 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001137601 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_042289 Rosetta Predictions human pricing
XR_042430 Rosetta Predictions human pricing
XR_042458 Rosetta Predictions human pricing
NM_001126302 Rosetta Predictions rat pricing
XM_001477883 Rosetta Predictions mouse pricing
XM_356600 Rosetta Predictions mouse pricing
XM_914337 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00533690 predicted 1073
2 SASI_Hs02_00533691 predicted 1264
3 SASI_Hs02_00533692 predicted 848
4 SASI_Hs02_00533693 predicted 1093
5 SASI_Hs02_00533694 predicted 1290
6 SASI_Hs02_00533695 predicted 1128
7 SASI_Hs02_00533696 predicted 283
8 SASI_Hs02_00533697 predicted 1022
9 SASI_Hs02_00533698 predicted 1915
10 SASI_Hs02_00533699 predicted 1291
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00534394 predicted 1075
2 SASI_Hs02_00534395 predicted 1266
3 SASI_Hs02_00534396 predicted 848
4 SASI_Hs02_00534397 predicted 1085
5 SASI_Hs02_00534398 predicted 1290
6 SASI_Hs02_00534399 predicted 1130
7 SASI_Hs02_00534400 predicted 284
8 SASI_Hs02_00534401 predicted 1028
9 SASI_Hs02_00534402 predicted 1920
10 SASI_Hs02_00534403 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_042458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00534576 predicted 1074
2 SASI_Hs02_00534577 predicted 1268
3 SASI_Hs02_00534578 predicted 851
4 SASI_Hs02_00534579 predicted 1092
5 SASI_Hs02_00534580 predicted 1291
6 SASI_Hs02_00534581 predicted 286
7 SASI_Hs02_00534582 predicted 1025
8 SASI_Hs02_00534583 predicted 1912
9 SASI_Hs02_00534584 predicted 1289
10 SASI_Hs02_00534585 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126302 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253393 predicted 300
2 SASI_Rn02_00253394 predicted 1190
3 SASI_Rn02_00253395 predicted 997
4 SASI_Rn02_00253396 predicted 233
5 SASI_Rn02_00253397 predicted 447
6 SASI_Rn02_00253398 predicted 992
7 SASI_Rn02_00253399 predicted 881
8 SASI_Rn02_00253400 predicted 1312
9 SASI_Rn02_00253401 predicted 633
10 SASI_Rn02_00253402 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001477883 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00398729 predicted 1189
2 SASI_Mm02_00398730 predicted 1783
3 SASI_Mm02_00398731 predicted 1596
4 SASI_Mm02_00398732 predicted 1585
5 SASI_Mm02_00398733 predicted 425
6 SASI_Mm02_00398734 predicted 1777
7 SASI_Mm02_00398735 predicted 1589
8 SASI_Mm02_00398736 predicted 631
9 SASI_Mm02_00398737 predicted 422
10 SASI_Mm02_00398738 predicted 1764
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356600 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242982 predicted 1195
2 SASI_Mm01_00242983 predicted 1781
3 SASI_Mm01_00242985 predicted 1601
4 SASI_Mm01_00242986 predicted 1578
5 SASI_Mm01_00242987 predicted 426
6 SASI_Mm01_00242988 predicted 1775
7 SASI_Mm02_00425965 predicted 1587
8 SASI_Mm01_00242989 predicted 626
9 SASI_Mm02_00425966 predicted 424
10 SASI_Mm01_00242990 predicted 1767
11 SASI_Mm01_00242984 predicted 984
12 SASI_Mm01_00242991 predicted 1728
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_914337 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438467 predicted 1197
2 SASI_Mm02_00438468 predicted 1782
3 SASI_Mm02_00438469 predicted 1599
4 SASI_Mm02_00438470 predicted 1584
5 SASI_Mm02_00438471 predicted 421
6 SASI_Mm02_00438472 predicted 1768
7 SASI_Mm02_00438473 predicted 1585
8 SASI_Mm02_00438474 predicted 627
9 SASI_Mm02_00438475 predicted 428
10 SASI_Mm02_00438476 predicted 1768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001477883
ZBTB42 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 42
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-984s21c1
Sequence:CCGGCCAGCAGGCACCTTTGCATTTCTCGAGAAATGCAAAGGTGCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-787s21c1
Sequence:CCGGGGTGAAGGCTGAGCAAGATTCCTCGAGGAATCTTGCTCAGCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001477883.1-3119s21c1
Sequence:GTACCGGAGAATGGTGACTGGTTATATGCTCGAGCATATAACCAGTCACCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-1341s21c1
Sequence:CCGGATGTCCGCAAGTTCCACTATGCTCGAGCATAGTGGAACTTGCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-427s21c1
Sequence:CCGGCGCCAGTTACCTGCACATGTACTCGAGTACATGTGCAGGTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001477883
ZBTB42 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 42
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-984s21c1
Sequence:CCGGCCAGCAGGCACCTTTGCATTTCTCGAGAAATGCAAAGGTGCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-787s21c1
Sequence:CCGGGGTGAAGGCTGAGCAAGATTCCTCGAGGAATCTTGCTCAGCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001477883.1-3119s21c1
Sequence:GTACCGGAGAATGGTGACTGGTTATATGCTCGAGCATATAACCAGTCACCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-1341s21c1
Sequence:CCGGATGTCCGCAAGTTCCACTATGCTCGAGCATAGTGGAACTTGCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-427s21c1
Sequence:CCGGCGCCAGTTACCTGCACATGTACTCGAGTACATGTGCAGGTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001477883
ZBTB42 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 42
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-984s21c1
Sequence:CCGGCCAGCAGGCACCTTTGCATTTCTCGAGAAATGCAAAGGTGCCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-787s21c1
Sequence:CCGGGGTGAAGGCTGAGCAAGATTCCTCGAGGAATCTTGCTCAGCCTTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001477883.1-3119s21c1
Sequence:GTACCGGAGAATGGTGACTGGTTATATGCTCGAGCATATAACCAGTCACCATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-1341s21c1
Sequence:CCGGATGTCCGCAAGTTCCACTATGCTCGAGCATAGTGGAACTTGCGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001477883.1-427s21c1
Sequence:CCGGCGCCAGTTACCTGCACATGTACTCGAGTACATGTGCAGGTAACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001137601
ZBTB42 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 42
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-353s21c1
Sequence:CCGGCCGCCTACTGGACTTCATGTACTCGAGTACATGAAGTCCAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-477s21c1
Sequence:CCGGCAGGAGAAGGATCGAAGTCTGCTCGAGCAGACTTCGATCCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-259s21c1
Sequence:CCGGGCGTCTACTTCCATCTCTTCTCTCGAGAGAAGAGATGGAAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-1012s21c1
Sequence:CCGGCGTTGTGCAGCAAGCTGTTTCCTCGAGGAAACAGCTTGCTGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137601.1-2776s21c1
Sequence:CCGGCCAGCCAAGTCTACGTTATTTCTCGAGAAATAACGTAGACTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001137601
ZBTB42 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 42
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-353s21c1
Sequence:CCGGCCGCCTACTGGACTTCATGTACTCGAGTACATGAAGTCCAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-477s21c1
Sequence:CCGGCAGGAGAAGGATCGAAGTCTGCTCGAGCAGACTTCGATCCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-259s21c1
Sequence:CCGGGCGTCTACTTCCATCTCTTCTCTCGAGAGAAGAGATGGAAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-1012s21c1
Sequence:CCGGCGTTGTGCAGCAAGCTGTTTCCTCGAGGAAACAGCTTGCTGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137601.1-2776s21c1
Sequence:CCGGCCAGCCAAGTCTACGTTATTTCTCGAGAAATAACGTAGACTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001137601
ZBTB42 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 42
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-353s21c1
Sequence:CCGGCCGCCTACTGGACTTCATGTACTCGAGTACATGAAGTCCAGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-477s21c1
Sequence:CCGGCAGGAGAAGGATCGAAGTCTGCTCGAGCAGACTTCGATCCTTCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-259s21c1
Sequence:CCGGGCGTCTACTTCCATCTCTTCTCTCGAGAGAAGAGATGGAAGTAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001137601.1-1012s21c1
Sequence:CCGGCGTTGTGCAGCAAGCTGTTTCCTCGAGGAAACAGCTTGCTGCACAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001137601.1-2776s21c1
Sequence:CCGGCCAGCCAAGTCTACGTTATTTCTCGAGAAATAACGTAGACTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks