EMAIL THIS PAGE TO A FRIEND

ZBTB43

zinc finger and BTB domain containing 43

Synonyms: ZBTB22B ZNF-X ZNF297B
UniProtKB ID: O43298, Q5JU96
Gene ID:
Mouse(71834) zinc finger and BTB domain containing 43
Rat(311872) zinc finger and BTB domain containing 43
Zebrafish(557590) zinc finger and BTB domain containing 43
chicken(417091) zinc finger and BTB domain containing 43
domestic cat(101086857) zinc finger and BTB domain containing 43
Horse(100067188) zinc finger and BTB domain containing 43
dog(612870) zinc finger and BTB domain containing 43
domestic guinea pig(100727951) zinc finger and BTB domain containing 43
naked mole-rat(101707828) zinc finger and BTB domain containing 43
cow(509462) zinc finger and BTB domain containing 43
sheep(101105227) zinc finger and BTB domain containing 43
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA016825 Anti-ZBTB43 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2102746 Anti-ZBTB43 antibody produced in rabbit affinity isolated antibody horse, rat, guinea pig, bovine, rabbit, human, mouse
western blot pricing
SAB2106456 Anti-ZBTB43 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, rabbit, horse, human
ELISA, western blot pricing
AV32978 Anti-ZNF297B (AB1) antibody produced in rabbit affinity isolated antibody human, canine, bovine, guinea pig, mouse, rat, horse, rabbit
western blot pricing
AV31799 Anti-ZNF297B (AB2) antibody produced in rabbit IgG fraction of antiserum bovine, mouse, guinea pig, rat, pig, canine, horse, human, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014007 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014007 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014007 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014007 Rosetta Predictions human pricing
NM_001012094 Rosetta Predictions rat pricing
XM_575117 Rosetta Predictions rat pricing
NM_001025594 Rosetta Predictions mouse pricing
NM_027947 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014007 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211126 predicted 417
2 SASI_Hs01_00211127 predicted 1105
3 SASI_Hs01_00211128 predicted 636
4 SASI_Hs01_00211129 predicted 1475
5 SASI_Hs01_00211131 predicted 1301
6 SASI_Hs01_00211132 predicted 1084
7 SASI_Hs02_00344977 predicted 1462
8 SASI_Hs01_00211134 predicted 1289
9 SASI_Hs02_00344978 predicted 1226
10 SASI_Hs01_00211135 predicted 445
11 SASI_Hs01_00211130 predicted 1249
12 SASI_Hs01_00211133 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012094 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084630 predicted 562
2 SASI_Rn01_00084631 predicted 495
3 SASI_Rn01_00084632 predicted 290
4 SASI_Rn01_00084633 predicted 502
5 SASI_Rn01_00084635 predicted 318
6 SASI_Rn01_00084636 predicted 1379
7 SASI_Rn01_00084637 predicted 1360
8 SASI_Rn01_00084638 predicted 356
9 SASI_Rn01_00084639 predicted 1534
10 SASI_Rn02_00200227 predicted 946
11 SASI_Rn01_00084634 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575117 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00155424 predicted 565
2 SASI_Rn01_00155425 predicted 501
3 SASI_Rn01_00155426 predicted 299
4 SASI_Rn01_00155427 predicted 513
5 SASI_Rn01_00155428 predicted 217
6 SASI_Rn01_00155429 predicted 321
7 SASI_Rn01_00155430 predicted 1384
8 SASI_Rn01_00155431 predicted 1371
9 SASI_Rn01_00155432 predicted 369
10 SASI_Rn01_00155433 predicted 1546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119065 predicted 1270
2 SASI_Mm01_00119066 predicted 471
3 SASI_Mm01_00119067 predicted 419
4 SASI_Mm01_00119068 predicted 1294
5 SASI_Mm01_00119069 predicted 1446
6 SASI_Mm01_00119070 predicted 1274
7 SASI_Mm01_00119071 predicted 1106
8 SASI_Mm01_00119072 predicted 399
9 SASI_Mm01_00119073 predicted 1122
10 SASI_Mm01_00119074 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027947 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139847 predicted 1361
2 SASI_Mm01_00139848 predicted 566
3 SASI_Mm01_00139849 predicted 510
4 SASI_Mm01_00139850 predicted 1381
5 SASI_Mm01_00139851 predicted 1539
6 SASI_Mm01_00139852 predicted 1367
7 SASI_Mm01_00139853 predicted 1204
8 SASI_Mm01_00139854 predicted 496
9 SASI_Mm01_00139855 predicted 1215
10 SASI_Mm01_00139856 predicted 942
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014007
VALIDATED
ZBTB43 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 43
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.3-349s21c1
Sequence:CCGGCAGCGCCAGCAAGGACAATTACTCGAGTAATTGTCCTTGCTGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.3-1306s21c1
Sequence:CCGGGCAGGTTACAGTGAGAATATTCTCGAGAATATTCTCACTGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.2-1738s21c1
Sequence:CCGGCAGCTAAGTAGGCCAATTAAACTCGAGTTTAATTGGCCTACTTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-1490s21c1
Sequence:CCGGTATCTGTGCAAAGAGGTTTATCTCGAGATAAACCTCTTTGCACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-1181s21c1
Sequence:CCGGGAGGTCAGATGGGAATCTAATCTCGAGATTAGATTCCCATCTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-624s21c1
Sequence:CCGGCCAAGCAGCAGTAGTTATAATCTCGAGATTATAACTACTGCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-446s21c1
Sequence:CCGGCATTCTCCTATCTAGTTATACCTCGAGGTATAACTAGATAGGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.3-3161s21c1
Sequence:CCGGACAATCGTACTGGGTTATTTACTCGAGTAAATAACCCAGTACGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.3-1816s21c1
Sequence:CCGGGCTCTAAGTAGGCCAATTAAACTCGAGTTTAATTGGCCTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-485s1c1
Sequence:CCGGCGCTCCAGAAATTGTTAGTTACTCGAGTAACTAACAATTTCTGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014007.2-428s1c1
Sequence:CCGGCCCAAGAGTGTTTGAGAACATCTCGAGATGTTCTCAAACACTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1532s1c1
Sequence:CCGGGCATGTGACTTCTTGTACTAACTCGAGTTAGTACAAGAAGTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1113s1c1
Sequence:CCGGGCTGATGAAAGCAATTATGATCTCGAGATCATAATTGCTTTCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1577s1c1
Sequence:CCGGGCAGAATACAACTGAGGCTAACTCGAGTTAGCCTCAGTTGTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014007
VALIDATED
ZBTB43 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 43
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.3-349s21c1
Sequence:CCGGCAGCGCCAGCAAGGACAATTACTCGAGTAATTGTCCTTGCTGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.3-1306s21c1
Sequence:CCGGGCAGGTTACAGTGAGAATATTCTCGAGAATATTCTCACTGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.2-1738s21c1
Sequence:CCGGCAGCTAAGTAGGCCAATTAAACTCGAGTTTAATTGGCCTACTTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-1490s21c1
Sequence:CCGGTATCTGTGCAAAGAGGTTTATCTCGAGATAAACCTCTTTGCACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-1181s21c1
Sequence:CCGGGAGGTCAGATGGGAATCTAATCTCGAGATTAGATTCCCATCTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-624s21c1
Sequence:CCGGCCAAGCAGCAGTAGTTATAATCTCGAGATTATAACTACTGCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-446s21c1
Sequence:CCGGCATTCTCCTATCTAGTTATACCTCGAGGTATAACTAGATAGGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.3-3161s21c1
Sequence:CCGGACAATCGTACTGGGTTATTTACTCGAGTAAATAACCCAGTACGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.3-1816s21c1
Sequence:CCGGGCTCTAAGTAGGCCAATTAAACTCGAGTTTAATTGGCCTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-485s1c1
Sequence:CCGGCGCTCCAGAAATTGTTAGTTACTCGAGTAACTAACAATTTCTGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014007.2-428s1c1
Sequence:CCGGCCCAAGAGTGTTTGAGAACATCTCGAGATGTTCTCAAACACTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1532s1c1
Sequence:CCGGGCATGTGACTTCTTGTACTAACTCGAGTTAGTACAAGAAGTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1113s1c1
Sequence:CCGGGCTGATGAAAGCAATTATGATCTCGAGATCATAATTGCTTTCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1577s1c1
Sequence:CCGGGCAGAATACAACTGAGGCTAACTCGAGTTAGCCTCAGTTGTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014007
VALIDATED
ZBTB43 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 43
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.3-349s21c1
Sequence:CCGGCAGCGCCAGCAAGGACAATTACTCGAGTAATTGTCCTTGCTGGCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.3-1306s21c1
Sequence:CCGGGCAGGTTACAGTGAGAATATTCTCGAGAATATTCTCACTGTAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232266    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.2-1738s21c1
Sequence:CCGGCAGCTAAGTAGGCCAATTAAACTCGAGTTTAATTGGCCTACTTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-1490s21c1
Sequence:CCGGTATCTGTGCAAAGAGGTTTATCTCGAGATAAACCTCTTTGCACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-1181s21c1
Sequence:CCGGGAGGTCAGATGGGAATCTAATCTCGAGATTAGATTCCCATCTGACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-624s21c1
Sequence:CCGGCCAAGCAGCAGTAGTTATAATCTCGAGATTATAACTACTGCTGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014007.2-446s21c1
Sequence:CCGGCATTCTCCTATCTAGTTATACCTCGAGGTATAACTAGATAGGAGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.3-3161s21c1
Sequence:CCGGACAATCGTACTGGGTTATTTACTCGAGTAAATAACCCAGTACGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014007.3-1816s21c1
Sequence:CCGGGCTCTAAGTAGGCCAATTAAACTCGAGTTTAATTGGCCTACTTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-485s1c1
Sequence:CCGGCGCTCCAGAAATTGTTAGTTACTCGAGTAACTAACAATTTCTGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_014007.2-428s1c1
Sequence:CCGGCCCAAGAGTGTTTGAGAACATCTCGAGATGTTCTCAAACACTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1532s1c1
Sequence:CCGGGCATGTGACTTCTTGTACTAACTCGAGTTAGTACAAGAAGTCACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1113s1c1
Sequence:CCGGGCTGATGAAAGCAATTATGATCTCGAGATCATAATTGCTTTCATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014007.2-1577s1c1
Sequence:CCGGGCAGAATACAACTGAGGCTAACTCGAGTTAGCCTCAGTTGTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025594
VALIDATED
ZBTB43 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 43
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025594.1-3255s21c1
Sequence:CCGGTGTATCAGTCTTGGCATATAACTCGAGTTATATGCCAAGACTGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025594.1-1569s21c1
Sequence:CCGGATACAACTGAGGCTAACTAAACTCGAGTTTAGTTAGCCTCAGTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-1170s21c1
Sequence:CCGGAGTTGGGTGGGAATCTAATTGCTCGAGCAATTAGATTCCCACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-987s21c1
Sequence:CCGGAGGTCACTGAATCCGTCAATACTCGAGTATTGACGGATTCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-748s21c1
Sequence:CCGGGGTCACCGAGCACGAGTATTTCTCGAGAAATACTCGTGCTCGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025594.1-4401s1c1
Sequence:CCGGCCCTAAATTCTCAGATACTTTCTCGAGAAAGTATCTGAGAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025594.1-1519s1c1
Sequence:CCGGGCATGTGACTTCTTGTACCAACTCGAGTTGGTACAAGAAGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025594.1-401s1c1
Sequence:CCGGCCCGATGTAATGAACCCAAGACTCGAGTCTTGGGTTCATTACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025594.1-757s1c1
Sequence:CCGGGCACGAGTATTTGCCCAGTAACTCGAGTTACTGGGCAAATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025594.1-1468s1c1
Sequence:CCGGCGAGTGTAATATCTGTGCAAACTCGAGTTTGCACAGATATTACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025594
VALIDATED
ZBTB43 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 43
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025594.1-3255s21c1
Sequence:CCGGTGTATCAGTCTTGGCATATAACTCGAGTTATATGCCAAGACTGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025594.1-1569s21c1
Sequence:CCGGATACAACTGAGGCTAACTAAACTCGAGTTTAGTTAGCCTCAGTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-1170s21c1
Sequence:CCGGAGTTGGGTGGGAATCTAATTGCTCGAGCAATTAGATTCCCACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-987s21c1
Sequence:CCGGAGGTCACTGAATCCGTCAATACTCGAGTATTGACGGATTCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-748s21c1
Sequence:CCGGGGTCACCGAGCACGAGTATTTCTCGAGAAATACTCGTGCTCGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025594.1-4401s1c1
Sequence:CCGGCCCTAAATTCTCAGATACTTTCTCGAGAAAGTATCTGAGAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025594.1-1519s1c1
Sequence:CCGGGCATGTGACTTCTTGTACCAACTCGAGTTGGTACAAGAAGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025594.1-401s1c1
Sequence:CCGGCCCGATGTAATGAACCCAAGACTCGAGTCTTGGGTTCATTACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025594.1-757s1c1
Sequence:CCGGGCACGAGTATTTGCCCAGTAACTCGAGTTACTGGGCAAATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025594.1-1468s1c1
Sequence:CCGGCGAGTGTAATATCTGTGCAAACTCGAGTTTGCACAGATATTACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025594
VALIDATED
ZBTB43 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 43
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025594.1-3255s21c1
Sequence:CCGGTGTATCAGTCTTGGCATATAACTCGAGTTATATGCCAAGACTGATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001025594.1-1569s21c1
Sequence:CCGGATACAACTGAGGCTAACTAAACTCGAGTTTAGTTAGCCTCAGTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245083    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-1170s21c1
Sequence:CCGGAGTTGGGTGGGAATCTAATTGCTCGAGCAATTAGATTCCCACCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-987s21c1
Sequence:CCGGAGGTCACTGAATCCGTCAATACTCGAGTATTGACGGATTCAGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025594.1-748s21c1
Sequence:CCGGGGTCACCGAGCACGAGTATTTCTCGAGAAATACTCGTGCTCGGTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096674    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025594.1-4401s1c1
Sequence:CCGGCCCTAAATTCTCAGATACTTTCTCGAGAAAGTATCTGAGAATTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025594.1-1519s1c1
Sequence:CCGGGCATGTGACTTCTTGTACCAACTCGAGTTGGTACAAGAAGTCACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025594.1-401s1c1
Sequence:CCGGCCCGATGTAATGAACCCAAGACTCGAGTCTTGGGTTCATTACATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001025594.1-757s1c1
Sequence:CCGGGCACGAGTATTTGCCCAGTAACTCGAGTTACTGGGCAAATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025594.1-1468s1c1
Sequence:CCGGCGAGTGTAATATCTGTGCAAACTCGAGTTTGCACAGATATTACACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks