EMAIL THIS PAGE TO A FRIEND

ZBTB44

zinc finger and BTB domain containing 44

Synonyms: BTBD15 HSPC063 ZNF851
UniProtKB ID: Q8NCP5, Q6IPT8, Q86VJ7, Q86XX5
Gene ID:
Mouse(235132) zinc finger and BTB domain containing 44
Rat(363035) zinc finger and BTB domain containing 44
cow(540532) zinc finger and BTB domain containing 44
sheep(101119946) zinc finger and BTB domain containing 44
naked mole-rat(101698326) zinc finger and BTB domain containing 44
Domestic Rabbit(100338293) zinc finger and BTB domain containing 44
domestic guinea pig(100713204) zinc finger and BTB domain containing 44
Zebrafish(569656) zinc finger and BTB domain containing 44
chicken(419732) zinc finger and BTB domain containing 44
Horse(100064712) zinc finger and BTB domain containing 44
domestic cat(101093458) zinc finger and BTB domain containing 44
dog(489277) zinc finger and BTB domain containing 44
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35874 Anti-BTBD15 antibody produced in rabbit affinity isolated antibody mouse, human, canine, bovine, rat, horse, guinea pig, rabbit
western blot pricing
SAB2108261 Anti-ZBTB44 antibody produced in rabbit affinity isolated antibody rat, canine, guinea pig, horse, human, bovine, mouse, rabbit
western blot pricing
SAB2102747 Anti-ZBTB44 antibody produced in rabbit affinity isolated antibody, lyophilized powder rabbit, rat, canine, mouse, horse, human, chicken, bovine
western blot pricing
HPA052589 Anti-ZBTB44 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014155 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014155 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014155 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001115130 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001115130 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001115130 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014155 Rosetta Predictions human pricing
NM_001034942 Rosetta Predictions rat pricing
NM_001115130 Rosetta Predictions mouse pricing
NM_172765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014155 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118388 predicted 593
2 SASI_Hs01_00118389 predicted 1275
3 SASI_Hs01_00118390 predicted 1384
4 SASI_Hs01_00118391 predicted 1343
5 SASI_Hs01_00118392 predicted 602
6 SASI_Hs01_00118393 predicted 970
7 SASI_Hs01_00118394 predicted 617
8 SASI_Hs01_00118396 predicted 1452
9 SASI_Hs01_00118397 predicted 1374
10 SASI_Hs02_00345146 predicted 1177
11 SASI_Hs01_00118395 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034942 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030844 predicted 1513
2 SASI_Rn01_00030845 predicted 479
3 SASI_Rn01_00030846 predicted 1143
4 SASI_Rn02_00204128 predicted 1426
5 SASI_Rn01_00030848 predicted 550
6 SASI_Rn01_00030849 predicted 1125
7 SASI_Rn02_00204129 predicted 1432
8 SASI_Rn01_00030851 predicted 1542
9 SASI_Rn02_00204130 predicted 1410
10 SASI_Rn01_00030852 predicted 817
11 SASI_Rn01_00030843 predicted 1042
12 SASI_Rn01_00030847 predicted 374
13 SASI_Rn01_00030850 predicted 1503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115130 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308957 predicted 1739
2 SASI_Mm02_00308958 predicted 1227
3 SASI_Mm02_00308959 predicted 685
4 SASI_Mm02_00308960 predicted 947
5 SASI_Mm02_00308961 predicted 578
6 SASI_Mm02_00308962 predicted 732
7 SASI_Mm02_00308963 predicted 592
8 SASI_Mm02_00308964 predicted 701
9 SASI_Mm02_00308965 predicted 1815
10 SASI_Mm02_00308966 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344639 predicted 1678
2 SASI_Mm01_00201538 predicted 1229
3 SASI_Mm01_00201539 predicted 685
4 SASI_Mm01_00201540 predicted 952
5 SASI_Mm01_00201541 predicted 575
6 SASI_Mm01_00201542 predicted 730
7 SASI_Mm01_00201544 predicted 593
8 SASI_Mm02_00344640 predicted 705
9 SASI_Mm02_00344641 predicted 1753
10 SASI_Mm02_00344642 predicted 1149
11 SASI_Mm01_00201537 predicted 1443
12 SASI_Mm01_00201543 predicted 654
13 SASI_Mm01_00201545 predicted 772
14 SASI_Mm01_00201546 predicted 1355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014155
ZBTB44 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 44
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-962s1c1
Sequence:CCGGCGAAGAAGATGTCCGGTCAAACTCGAGTTTGACCGGACATCTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-430s1c1
Sequence:CCGGCAGCAGCCAGCTATATGCAAACTCGAGTTTGCATATAGCTGGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-685s1c1
Sequence:CCGGCTCCTGAAAGTCCTGTAAAGTCTCGAGACTTTACAGGACTTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-871s1c1
Sequence:CCGGCTTTAGAATTACCTGGCCCATCTCGAGATGGGCCAGGTAATTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-840s1c1
Sequence:CCGGGAGAAAGTTAAGCACGCAGAACTCGAGTTCTGCGTGCTTAACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-913s1c1
Sequence:CCGGCTGATTATGTGACTTGTGAGACTCGAGTCTCACAAGTCACATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-907s1c1
Sequence:CCGGGAATGGCTGATTATGTGACTTCTCGAGAAGTCACATAATCAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-899s1c1
Sequence:CCGGCGGTAGAAGAATGGCTGATTACTCGAGTAATCAGCCATTCTTCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-951s1c1
Sequence:CCGGCCTTTAGGTACCGAAGAAGATCTCGAGATCTTCTTCGGTACCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-775s1c1
Sequence:CCGGCAGTTGACTCTTCCTTAGCTTCTCGAGAAGCTAAGGAAGAGTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-532s1c1
Sequence:CCGGGTCTAGATGCTGGACAAGAAACTCGAGTTTCTTGTCCAGCATCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-766s1c1
Sequence:CCGGGAAACCAACCAGTTGACTCTTCTCGAGAAGAGTCAACTGGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014155
ZBTB44 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 44
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-962s1c1
Sequence:CCGGCGAAGAAGATGTCCGGTCAAACTCGAGTTTGACCGGACATCTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-430s1c1
Sequence:CCGGCAGCAGCCAGCTATATGCAAACTCGAGTTTGCATATAGCTGGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-685s1c1
Sequence:CCGGCTCCTGAAAGTCCTGTAAAGTCTCGAGACTTTACAGGACTTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-871s1c1
Sequence:CCGGCTTTAGAATTACCTGGCCCATCTCGAGATGGGCCAGGTAATTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-840s1c1
Sequence:CCGGGAGAAAGTTAAGCACGCAGAACTCGAGTTCTGCGTGCTTAACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-913s1c1
Sequence:CCGGCTGATTATGTGACTTGTGAGACTCGAGTCTCACAAGTCACATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-907s1c1
Sequence:CCGGGAATGGCTGATTATGTGACTTCTCGAGAAGTCACATAATCAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-899s1c1
Sequence:CCGGCGGTAGAAGAATGGCTGATTACTCGAGTAATCAGCCATTCTTCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-951s1c1
Sequence:CCGGCCTTTAGGTACCGAAGAAGATCTCGAGATCTTCTTCGGTACCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-775s1c1
Sequence:CCGGCAGTTGACTCTTCCTTAGCTTCTCGAGAAGCTAAGGAAGAGTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-532s1c1
Sequence:CCGGGTCTAGATGCTGGACAAGAAACTCGAGTTTCTTGTCCAGCATCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-766s1c1
Sequence:CCGGGAAACCAACCAGTTGACTCTTCTCGAGAAGAGTCAACTGGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014155
ZBTB44 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 44
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-962s1c1
Sequence:CCGGCGAAGAAGATGTCCGGTCAAACTCGAGTTTGACCGGACATCTTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137052    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-430s1c1
Sequence:CCGGCAGCAGCCAGCTATATGCAAACTCGAGTTTGCATATAGCTGGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136439    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-685s1c1
Sequence:CCGGCTCCTGAAAGTCCTGTAAAGTCTCGAGACTTTACAGGACTTTCAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136374    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-871s1c1
Sequence:CCGGCTTTAGAATTACCTGGCCCATCTCGAGATGGGCCAGGTAATTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-840s1c1
Sequence:CCGGGAGAAAGTTAAGCACGCAGAACTCGAGTTCTGCGTGCTTAACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133787    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-913s1c1
Sequence:CCGGCTGATTATGTGACTTGTGAGACTCGAGTCTCACAAGTCACATAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134224    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-907s1c1
Sequence:CCGGGAATGGCTGATTATGTGACTTCTCGAGAAGTCACATAATCAGCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-899s1c1
Sequence:CCGGCGGTAGAAGAATGGCTGATTACTCGAGTAATCAGCCATTCTTCTACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-951s1c1
Sequence:CCGGCCTTTAGGTACCGAAGAAGATCTCGAGATCTTCTTCGGTACCTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135239    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014155.1-775s1c1
Sequence:CCGGCAGTTGACTCTTCCTTAGCTTCTCGAGAAGCTAAGGAAGAGTCAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-532s1c1
Sequence:CCGGGTCTAGATGCTGGACAAGAAACTCGAGTTTCTTGTCCAGCATCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014155.1-766s1c1
Sequence:CCGGGAAACCAACCAGTTGACTCTTCTCGAGAAGAGTCAACTGGTTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172765
ZBTB44 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 44
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-540s1c1
Sequence:CCGGCGAACCAAACTTGTTGGCCAACTCGAGTTGGCCAACAAGTTTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-1129s1c1
Sequence:CCGGCTTTAGAATTGCCTGGCCCATCTCGAGATGGGCCAGGCAATTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-1209s1c1
Sequence:CCGGCCTCTAGGTACAGAAGAAGATCTCGAGATCTTCTTCTGTACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-440s1c1
Sequence:CCGGGCTCCGAAATGATGGACATTTCTCGAGAAATGTCCATCATTTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-582s1c1
Sequence:CCGGGTGTTGGATCTGCATCATGTTCTCGAGAACATGATGCAGATCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172765.1-2095s1c1
Sequence:CCGGGCTGAGAGATTGCTTCTGTATCTCGAGATACAGAAGCAATCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172765
ZBTB44 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 44
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-540s1c1
Sequence:CCGGCGAACCAAACTTGTTGGCCAACTCGAGTTGGCCAACAAGTTTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-1129s1c1
Sequence:CCGGCTTTAGAATTGCCTGGCCCATCTCGAGATGGGCCAGGCAATTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-1209s1c1
Sequence:CCGGCCTCTAGGTACAGAAGAAGATCTCGAGATCTTCTTCTGTACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-440s1c1
Sequence:CCGGGCTCCGAAATGATGGACATTTCTCGAGAAATGTCCATCATTTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-582s1c1
Sequence:CCGGGTGTTGGATCTGCATCATGTTCTCGAGAACATGATGCAGATCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172765.1-2095s1c1
Sequence:CCGGGCTGAGAGATTGCTTCTGTATCTCGAGATACAGAAGCAATCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172765
ZBTB44 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 44
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198687    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-540s1c1
Sequence:CCGGCGAACCAAACTTGTTGGCCAACTCGAGTTGGCCAACAAGTTTGGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181253    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-1129s1c1
Sequence:CCGGCTTTAGAATTGCCTGGCCCATCTCGAGATGGGCCAGGCAATTCTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177746    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-1209s1c1
Sequence:CCGGCCTCTAGGTACAGAAGAAGATCTCGAGATCTTCTTCTGTACCTAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-440s1c1
Sequence:CCGGGCTCCGAAATGATGGACATTTCTCGAGAAATGTCCATCATTTCGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177983    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172765.1-582s1c1
Sequence:CCGGGTGTTGGATCTGCATCATGTTCTCGAGAACATGATGCAGATCCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172765.1-2095s1c1
Sequence:CCGGGCTGAGAGATTGCTTCTGTATCTCGAGATACAGAAGCAATCTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001115130
VALIDATED
ZBTB44 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 44
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1626s21c1
Sequence:CCGGCTTATCCACTCAGGAATTAAACTCGAGTTTAATTCCTGAGTGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1679s21c1
Sequence:CCGGTACCAGGGCTTACTCGCTAAACTCGAGTTTAGCGAGTAAGCCCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-736s21c1
Sequence:CCGGAGTTCATGAAGTCAAGTATTTCTCGAGAAATACTTGACTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1729s21c1
Sequence:CCGGCTTAGTACCGGACTACTTAAACTCGAGTTTAAGTAGTCCGGTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-2770s21c1
Sequence:CCGGACTATTGTGCTGCCATATAAACTCGAGTTTATATGGCAGCACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001115130
VALIDATED
ZBTB44 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 44
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1626s21c1
Sequence:CCGGCTTATCCACTCAGGAATTAAACTCGAGTTTAATTCCTGAGTGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1679s21c1
Sequence:CCGGTACCAGGGCTTACTCGCTAAACTCGAGTTTAGCGAGTAAGCCCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-736s21c1
Sequence:CCGGAGTTCATGAAGTCAAGTATTTCTCGAGAAATACTTGACTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1729s21c1
Sequence:CCGGCTTAGTACCGGACTACTTAAACTCGAGTTTAAGTAGTCCGGTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-2770s21c1
Sequence:CCGGACTATTGTGCTGCCATATAAACTCGAGTTTATATGGCAGCACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001115130
VALIDATED
ZBTB44 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 44
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1626s21c1
Sequence:CCGGCTTATCCACTCAGGAATTAAACTCGAGTTTAATTCCTGAGTGGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1679s21c1
Sequence:CCGGTACCAGGGCTTACTCGCTAAACTCGAGTTTAGCGAGTAAGCCCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-736s21c1
Sequence:CCGGAGTTCATGAAGTCAAGTATTTCTCGAGAAATACTTGACTTCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-1729s21c1
Sequence:CCGGCTTAGTACCGGACTACTTAAACTCGAGTTTAAGTAGTCCGGTACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243539    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001115130.1-2770s21c1
Sequence:CCGGACTATTGTGCTGCCATATAAACTCGAGTTTATATGGCAGCACAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks