EMAIL THIS PAGE TO A FRIEND

ZBTB45

zinc finger and BTB domain containing 45

Synonyms: ZNF499
UniProtKB ID: Q96K62
Gene ID:
Mouse(232879) zinc finger and BTB domain containing 45
Rat(308366) zinc finger and BTB domain containing 45
chicken(776930) zinc finger and BTB domain containing 45
domestic cat(101086434) zinc finger and BTB domain containing 45
dog(484222) zinc finger and BTB domain containing 45
domestic guinea pig(100727932) zinc finger and BTB domain containing 45
naked mole-rat(101723571) zinc finger and BTB domain containing 45
cow(506887) zinc finger and BTB domain containing 45
sheep(101120944) zinc finger and BTB domain containing 45
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035754 Anti-ZBTB45 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV30017 Anti-ZNF499 (AB1) antibody produced in rabbit affinity isolated antibody mouse, rat, rabbit, canine, human
immunohistochemistry, western blot pricing
AV30018 Anti-ZNF499 (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, rat, human, rabbit, canine, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032792 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032792 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032792 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032792 Rosetta Predictions human pricing
NM_001107478 Rosetta Predictions rat pricing
NM_001024699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032792 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018454 predicted 630
2 SASI_Hs01_00018455 predicted 1130
3 SASI_Hs02_00360353 predicted 1542
4 SASI_Hs02_00360354 predicted 1585
5 SASI_Hs01_00018456 predicted 1518
6 SASI_Hs01_00018457 predicted 518
7 SASI_Hs01_00018458 predicted 1474
8 SASI_Hs01_00018459 predicted 1901
9 SASI_Hs01_00018460 predicted 384
10 SASI_Hs01_00018461 predicted 1694
11 SASI_Hs01_00018462 predicted 549
12 SASI_Hs01_00018463 predicted 1218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229225 predicted 359
2 SASI_Rn02_00229226 predicted 1749
3 SASI_Rn02_00229227 predicted 1037
4 SASI_Rn02_00229228 predicted 770
5 SASI_Rn02_00229229 predicted 1546
6 SASI_Rn02_00229230 predicted 1527
7 SASI_Rn02_00229231 predicted 555
8 SASI_Rn02_00229232 predicted 1653
9 SASI_Rn02_00229233 predicted 1624
10 SASI_Rn02_00229234 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146575 predicted 1154
2 SASI_Mm01_00146576 predicted 1340
3 SASI_Mm01_00146577 predicted 1521
4 SASI_Mm01_00146578 predicted 958
5 SASI_Mm01_00146579 predicted 1535
6 SASI_Mm01_00146580 predicted 1886
7 SASI_Mm01_00146581 predicted 1368
8 SASI_Mm01_00146582 predicted 1346
9 SASI_Mm02_00287662 predicted 956
10 SASI_Mm01_00146583 predicted 381
11 SASI_Mm01_00146574 predicted 1113
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032792
VALIDATED
ZBTB45 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 45
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032792.2-2221s21c1
Sequence:CCGGGCTCTCTACCCAAGCTGTTACCTCGAGGTAACAGCTTGGGTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-1136s21c1
Sequence:CCGGGTATTTCCAGACAGCTATGTACTCGAGTACATAGCTGTCTGGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-345s21c1
Sequence:CCGGCTCTGCTTGAGACCCTCAATGCTCGAGCATTGAGGGTCTCAAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-1621s21c1
Sequence:CCGGCGACTACCTGCTCAAACACATCTCGAGATGTGTTTGAGCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032792.2-638s21c1
Sequence:CCGGGACGAATGCACGCAGATTATCCTCGAGGATAATCTGCGTGCATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-2072s1c1
Sequence:CCGGCTGGACTATTTCCTGCGTAAACTCGAGTTTACGCAGGAAATAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-616s1c1
Sequence:CCGGGCTTCGCATACAGACAGTTATCTCGAGATAACTGTCTGTATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1136s1c1
Sequence:CCGGGTATTTCCAGACAGCTATGTACTCGAGTACATAGCTGTCTGGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1621s1c1
Sequence:CCGGCGACTACCTGCTCAAACACATCTCGAGATGTGTTTGAGCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1221s1c1
Sequence:CCGGCCGACTGCATACTGTCTGGATCTCGAGATCCAGACAGTATGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032792
VALIDATED
ZBTB45 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 45
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032792.2-2221s21c1
Sequence:CCGGGCTCTCTACCCAAGCTGTTACCTCGAGGTAACAGCTTGGGTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-1136s21c1
Sequence:CCGGGTATTTCCAGACAGCTATGTACTCGAGTACATAGCTGTCTGGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-345s21c1
Sequence:CCGGCTCTGCTTGAGACCCTCAATGCTCGAGCATTGAGGGTCTCAAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-1621s21c1
Sequence:CCGGCGACTACCTGCTCAAACACATCTCGAGATGTGTTTGAGCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032792.2-638s21c1
Sequence:CCGGGACGAATGCACGCAGATTATCCTCGAGGATAATCTGCGTGCATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-2072s1c1
Sequence:CCGGCTGGACTATTTCCTGCGTAAACTCGAGTTTACGCAGGAAATAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-616s1c1
Sequence:CCGGGCTTCGCATACAGACAGTTATCTCGAGATAACTGTCTGTATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1136s1c1
Sequence:CCGGGTATTTCCAGACAGCTATGTACTCGAGTACATAGCTGTCTGGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1621s1c1
Sequence:CCGGCGACTACCTGCTCAAACACATCTCGAGATGTGTTTGAGCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1221s1c1
Sequence:CCGGCCGACTGCATACTGTCTGGATCTCGAGATCCAGACAGTATGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032792
VALIDATED
ZBTB45 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 45
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_032792.2-2221s21c1
Sequence:CCGGGCTCTCTACCCAAGCTGTTACCTCGAGGTAACAGCTTGGGTAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-1136s21c1
Sequence:CCGGGTATTTCCAGACAGCTATGTACTCGAGTACATAGCTGTCTGGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-345s21c1
Sequence:CCGGCTCTGCTTGAGACCCTCAATGCTCGAGCATTGAGGGTCTCAAGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032792.2-1621s21c1
Sequence:CCGGCGACTACCTGCTCAAACACATCTCGAGATGTGTTTGAGCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_032792.2-638s21c1
Sequence:CCGGGACGAATGCACGCAGATTATCCTCGAGGATAATCTGCGTGCATTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108005    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-2072s1c1
Sequence:CCGGCTGGACTATTTCCTGCGTAAACTCGAGTTTACGCAGGAAATAGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-616s1c1
Sequence:CCGGGCTTCGCATACAGACAGTTATCTCGAGATAACTGTCTGTATGCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1136s1c1
Sequence:CCGGGTATTTCCAGACAGCTATGTACTCGAGTACATAGCTGTCTGGAAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1621s1c1
Sequence:CCGGCGACTACCTGCTCAAACACATCTCGAGATGTGTTTGAGCAGGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_032792.2-1221s1c1
Sequence:CCGGCCGACTGCATACTGTCTGGATCTCGAGATCCAGACAGTATGCAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024699
VALIDATED
ZBTB45 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 45
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024699.1-904s21c1
Sequence:CCGGCCACTGGCATCACTGATTATGCTCGAGCATAATCAGTGATGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-1813s21c1
Sequence:CCGGTTGGGACCCAGAACCCTATTTCTCGAGAAATAGGGTTCTGGGTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-969s21c1
Sequence:GTACCGGGATGTGTTCCCAGATAGTTATCTCGAGATAACTATCTGGGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-1475s21c1
Sequence:CCGGCGATTACCTGCTCAAGCATATCTCGAGATATGCTTGAGCAGGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-445s21c1
Sequence:CCGGTTCGCATCCAGACCGTCATTGCTCGAGCAATGACGGTCTGGATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024699
VALIDATED
ZBTB45 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 45
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024699.1-904s21c1
Sequence:CCGGCCACTGGCATCACTGATTATGCTCGAGCATAATCAGTGATGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-1813s21c1
Sequence:CCGGTTGGGACCCAGAACCCTATTTCTCGAGAAATAGGGTTCTGGGTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-969s21c1
Sequence:GTACCGGGATGTGTTCCCAGATAGTTATCTCGAGATAACTATCTGGGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-1475s21c1
Sequence:CCGGCGATTACCTGCTCAAGCATATCTCGAGATATGCTTGAGCAGGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-445s21c1
Sequence:CCGGTTCGCATCCAGACCGTCATTGCTCGAGCAATGACGGTCTGGATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024699
VALIDATED
ZBTB45 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 45
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024699.1-904s21c1
Sequence:CCGGCCACTGGCATCACTGATTATGCTCGAGCATAATCAGTGATGCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234179    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-1813s21c1
Sequence:CCGGTTGGGACCCAGAACCCTATTTCTCGAGAAATAGGGTTCTGGGTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-969s21c1
Sequence:GTACCGGGATGTGTTCCCAGATAGTTATCTCGAGATAACTATCTGGGAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234178    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-1475s21c1
Sequence:CCGGCGATTACCTGCTCAAGCATATCTCGAGATATGCTTGAGCAGGTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024699.1-445s21c1
Sequence:CCGGTTCGCATCCAGACCGTCATTGCTCGAGCAATGACGGTCTGGATGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks