EMAIL THIS PAGE TO A FRIEND

ZBTB46

zinc finger and BTB domain containing 46

Synonyms: BTBD4 BZEL RINZF ZNF340 dJ583P15.7 dJ583P15.8
Gene ID:
Mouse(72147) zinc finger and BTB domain containing 46
Rat(311718) zinc finger and BTB domain containing 46
cow(507985) zinc finger and BTB domain containing 46
sheep(101117096) zinc finger and BTB domain containing 46
naked mole-rat(101697314) zinc finger and BTB domain containing 46
domestic guinea pig(100729315) zinc finger and BTB domain containing 46
Zebrafish(570537) zinc finger and BTB domain containing 46
chicken(419259) zinc finger and BTB domain containing 46
domestic cat(101092673) zinc finger and BTB domain containing 46
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028125 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028125 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028125 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025224 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025224 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025224 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025224 Rosetta Predictions human pricing
NM_001107808 Rosetta Predictions rat pricing
NM_028125 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025224 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00043740 predicted 495
2 SASI_Hs01_00043743 predicted 452
3 SASI_Hs01_00043744 predicted 488
4 SASI_Hs01_00043745 predicted 1466
5 SASI_Hs01_00043746 predicted 508
6 SASI_Hs01_00043747 predicted 660
7 SASI_Hs01_00043748 predicted 1416
8 SASI_Hs01_00043749 predicted 2015
9 SASI_Hs02_00358024 predicted 1174
10 SASI_Hs02_00358025 predicted 551
11 SASI_Hs01_00043741 predicted 821
12 SASI_Hs01_00043742 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232475 predicted 772
2 SASI_Rn02_00232476 predicted 1932
3 SASI_Rn02_00232477 predicted 778
4 SASI_Rn02_00232478 predicted 424
5 SASI_Rn02_00232479 predicted 1936
6 SASI_Rn02_00232480 predicted 782
7 SASI_Rn02_00232481 predicted 204
8 SASI_Rn02_00232482 predicted 283
9 SASI_Rn02_00232483 predicted 652
10 SASI_Rn02_00232484 predicted 1901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028125 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178279 predicted 954
2 SASI_Mm01_00178280 predicted 826
3 SASI_Mm01_00178281 predicted 1457
4 SASI_Mm01_00178282 predicted 498
5 SASI_Mm01_00178283 predicted 222
6 SASI_Mm01_00178284 predicted 1612
7 SASI_Mm01_00178285 predicted 225
8 SASI_Mm01_00178286 predicted 1521
9 SASI_Mm01_00178287 predicted 1369
10 SASI_Mm01_00178288 predicted 460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028125
ZBTB46 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 46
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028125.1-2420s1c1
Sequence:CCGGCGCTGAATTACAGGACCGTTTCTCGAGAAACGGTCCTGTAATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-321s1c1
Sequence:CCGGGCAAGGTCTTCAAGGCACATACTCGAGTATGTGCCTTGAAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-1231s1c1
Sequence:CCGGAGGAGGAGAAACCAGCTACTTCTCGAGAAGTAGCTGGTTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-1358s1c1
Sequence:CCGGGCTGACGTGCTCGGTGATGATCTCGAGATCATCACCGAGCACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-364s1c1
Sequence:CCGGCCGCTACTTTAAGACGCTCTACTCGAGTAGAGCGTCTTAAAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028125
ZBTB46 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 46
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028125.1-2420s1c1
Sequence:CCGGCGCTGAATTACAGGACCGTTTCTCGAGAAACGGTCCTGTAATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-321s1c1
Sequence:CCGGGCAAGGTCTTCAAGGCACATACTCGAGTATGTGCCTTGAAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-1231s1c1
Sequence:CCGGAGGAGGAGAAACCAGCTACTTCTCGAGAAGTAGCTGGTTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-1358s1c1
Sequence:CCGGGCTGACGTGCTCGGTGATGATCTCGAGATCATCACCGAGCACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-364s1c1
Sequence:CCGGCCGCTACTTTAAGACGCTCTACTCGAGTAGAGCGTCTTAAAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028125
ZBTB46 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 46
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125839    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028125.1-2420s1c1
Sequence:CCGGCGCTGAATTACAGGACCGTTTCTCGAGAAACGGTCCTGTAATTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-321s1c1
Sequence:CCGGGCAAGGTCTTCAAGGCACATACTCGAGTATGTGCCTTGAAGACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-1231s1c1
Sequence:CCGGAGGAGGAGAAACCAGCTACTTCTCGAGAAGTAGCTGGTTTCTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-1358s1c1
Sequence:CCGGGCTGACGTGCTCGGTGATGATCTCGAGATCATCACCGAGCACGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028125.1-364s1c1
Sequence:CCGGCCGCTACTTTAAGACGCTCTACTCGAGTAGAGCGTCTTAAAGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025224
ZBTB46 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 46
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025224.2-3941s1c1
Sequence:CCGGGCATTTGGAAACCAGACCTTTCTCGAGAAAGGTCTGGTTTCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-829s1c1
Sequence:CCGGGATGTTTCTTCACAGCCTCTACTCGAGTAGAGGCTGTGAAGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1446s1c1
Sequence:CCGGGAAGAAGTTCAAGTGTCCGTACTCGAGTACGGACACTTGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025224.2-4191s1c1
Sequence:CCGGCGTGGCAGATTTCCTGTTCTTCTCGAGAAGAACAGGAAATCTGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1602s1c1
Sequence:CCGGCCACAGCAAGGACAAGAAGTACTCGAGTACTTCTTGTCCTTGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-945s1c1
Sequence:CCGGCGGTGCAGTACAGAACTCTTTCTCGAGAAAGAGTTCTGTACTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-1422s1c1
Sequence:CCGGCCTGAATGAGTTCACGGTGATCTCGAGATCACCGTGAACTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-362s1c1
Sequence:CCGGGCTACTTCAAGACGCTCTACTCTCGAGAGTAGAGCGTCTTGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1320s1c1
Sequence:CCGGGCTCATGAGTAAGAACAGCCTCTCGAGAGGCTGTTCTTACTCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-450s1c1
Sequence:CCGGCAAGGCCATCATCGACTTCATCTCGAGATGAAGTCGATGATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025224
ZBTB46 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 46
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025224.2-3941s1c1
Sequence:CCGGGCATTTGGAAACCAGACCTTTCTCGAGAAAGGTCTGGTTTCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-829s1c1
Sequence:CCGGGATGTTTCTTCACAGCCTCTACTCGAGTAGAGGCTGTGAAGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1446s1c1
Sequence:CCGGGAAGAAGTTCAAGTGTCCGTACTCGAGTACGGACACTTGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025224.2-4191s1c1
Sequence:CCGGCGTGGCAGATTTCCTGTTCTTCTCGAGAAGAACAGGAAATCTGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1602s1c1
Sequence:CCGGCCACAGCAAGGACAAGAAGTACTCGAGTACTTCTTGTCCTTGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-945s1c1
Sequence:CCGGCGGTGCAGTACAGAACTCTTTCTCGAGAAAGAGTTCTGTACTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-1422s1c1
Sequence:CCGGCCTGAATGAGTTCACGGTGATCTCGAGATCACCGTGAACTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-362s1c1
Sequence:CCGGGCTACTTCAAGACGCTCTACTCTCGAGAGTAGAGCGTCTTGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1320s1c1
Sequence:CCGGGCTCATGAGTAAGAACAGCCTCTCGAGAGGCTGTTCTTACTCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-450s1c1
Sequence:CCGGCAAGGCCATCATCGACTTCATCTCGAGATGAAGTCGATGATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025224
ZBTB46 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 46
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153223    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025224.2-3941s1c1
Sequence:CCGGGCATTTGGAAACCAGACCTTTCTCGAGAAAGGTCTGGTTTCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152836    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-829s1c1
Sequence:CCGGGATGTTTCTTCACAGCCTCTACTCGAGTAGAGGCTGTGAAGAAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1446s1c1
Sequence:CCGGGAAGAAGTTCAAGTGTCCGTACTCGAGTACGGACACTTGAACTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025224.2-4191s1c1
Sequence:CCGGCGTGGCAGATTTCCTGTTCTTCTCGAGAAGAACAGGAAATCTGCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1602s1c1
Sequence:CCGGCCACAGCAAGGACAAGAAGTACTCGAGTACTTCTTGTCCTTGCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-945s1c1
Sequence:CCGGCGGTGCAGTACAGAACTCTTTCTCGAGAAAGAGTTCTGTACTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-1422s1c1
Sequence:CCGGCCTGAATGAGTTCACGGTGATCTCGAGATCACCGTGAACTCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025224.2-362s1c1
Sequence:CCGGGCTACTTCAAGACGCTCTACTCTCGAGAGTAGAGCGTCTTGAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-1320s1c1
Sequence:CCGGGCTCATGAGTAAGAACAGCCTCTCGAGAGGCTGTTCTTACTCATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025224.2-450s1c1
Sequence:CCGGCAAGGCCATCATCGACTTCATCTCGAGATGAAGTCGATGATGGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027656
ZBTB46 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 46
Mouse
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000444406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027656.1-1578s21c1
Sequence:CCGGAGAGCACATGAAGCGACATACCTCGAGGTATGTCGCTTCATGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027656.1-2065s21c1
Sequence:CCGGGTGTGTCTTAGTGGATCTTTACTCGAGTAAAGATCCACTAAGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027656
ZBTB46 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 46
Mouse
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000444406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027656.1-1578s21c1
Sequence:CCGGAGAGCACATGAAGCGACATACCTCGAGGTATGTCGCTTCATGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027656.1-2065s21c1
Sequence:CCGGGTGTGTCTTAGTGGATCTTTACTCGAGTAAAGATCCACTAAGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027656
ZBTB46 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 46
Mouse
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000444406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027656.1-1578s21c1
Sequence:CCGGAGAGCACATGAAGCGACATACCTCGAGGTATGTCGCTTCATGTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027656.1-2065s21c1
Sequence:CCGGGTGTGTCTTAGTGGATCTTTACTCGAGTAAAGATCCACTAAGACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks