EMAIL THIS PAGE TO A FRIEND

ZBTB47

zinc finger and BTB domain containing 47

Synonyms: ZNF651
UniProtKB ID: Q9UFB7, Q8WTY8, Q9ULN0
Gene ID:
Rat(316087) zinc finger and BTB domain containing 47
chicken(428398) zinc finger and BTB domain containing 47
domestic cat(101095367) zinc finger and BTB domain containing 47
domestic guinea pig(100712770) zinc finger and BTB domain containing 47
naked mole-rat(101715256) zinc finger and BTB domain containing 47
cow(100335506) zinc finger and BTB domain containing 47
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145166 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145331 MISSION® esiRNA esiRNA human ZBTB47 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145166 Rosetta Predictions human pricing
XM_236722 Rosetta Predictions rat pricing
XR_009196 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026801 predicted 709
2 SASI_Hs02_00365013 predicted 525
3 SASI_Hs01_00026802 predicted 481
4 SASI_Hs02_00365014 predicted 533
5 SASI_Hs01_00026804 predicted 439
6 SASI_Hs01_00026805 predicted 448
7 SASI_Hs01_00026806 predicted 280
8 SASI_Hs01_00026807 predicted 280
9 SASI_Hs01_00026808 predicted 283
10 SASI_Hs01_00026809 predicted 269
11 SASI_Hs01_00026803 predicted 609
12 SASI_Hs01_00026810 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390369 predicted 2308
2 SASI_Rn02_00390370 predicted 2083
3 SASI_Rn02_00390371 predicted 2157
4 SASI_Rn02_00390372 predicted 2026
5 SASI_Rn02_00390373 predicted 2207
6 SASI_Rn02_00390374 predicted 2036
7 SASI_Rn02_00390375 predicted 2229
8 SASI_Rn02_00390376 predicted 2209
9 SASI_Rn02_00390377 predicted 2037
10 SASI_Rn02_00390378 predicted 1929
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00419041 predicted 746
2 SASI_Rn02_00419042 predicted 482
3 SASI_Rn02_00419043 predicted 766
4 SASI_Rn01_00147542 predicted 438
5 SASI_Rn02_00419044 predicted 509
6 SASI_Rn02_00419045 predicted 399
7 SASI_Rn02_00419046 predicted 716
8 SASI_Rn02_00419047 predicted 467
9 SASI_Rn02_00419048 predicted 6276
10 SASI_Rn02_00419049 predicted 6354
11 SASI_Rn01_00147539 predicted 2600
12 SASI_Rn01_00147540 predicted 1705
13 SASI_Rn01_00147541 predicted 5829
14 SASI_Rn01_00147543 predicted 6066
15 SASI_Rn01_00147544 predicted 1977
16 SASI_Rn01_00147545 predicted 3940
17 SASI_Rn01_00147546 predicted 2216
18 SASI_Rn01_00147547 predicted 258
19 SASI_Rn01_00147548 predicted 2139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145166
ZBTB47 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 47
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145166.3-2170s21c1
Sequence:CCGGAGCCGTACATCTGCGAGATCTCTCGAGAGATCTCGCAGATGTACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145166.3-485s21c1
Sequence:CCGGGCAGATCCTCAACTTCATCTACTCGAGTAGATGAAGTTGAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-489s1c1
Sequence:CCGGCCATGAGCATAACAAGATTGTCTCGAGACAATCTTGTTATGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-750s1c1
Sequence:CCGGGTCACACATGAGCATCCACATCTCGAGATGTGGATGCTCATGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145166.2-3014s1c1
Sequence:CCGGCCTGCTTTACTGTAGCTCTTTCTCGAGAAAGAGCTACAGTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-525s1c1
Sequence:CCGGGAAGAAGTTCTCATGCGAGATCTCGAGATCTCGCATGAGAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-693s1c1
Sequence:CCGGGAAGCCGTTCAGATGTGAGAACTCGAGTTCTCACATCTGAACGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145166
ZBTB47 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 47
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145166.3-2170s21c1
Sequence:CCGGAGCCGTACATCTGCGAGATCTCTCGAGAGATCTCGCAGATGTACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145166.3-485s21c1
Sequence:CCGGGCAGATCCTCAACTTCATCTACTCGAGTAGATGAAGTTGAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-489s1c1
Sequence:CCGGCCATGAGCATAACAAGATTGTCTCGAGACAATCTTGTTATGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-750s1c1
Sequence:CCGGGTCACACATGAGCATCCACATCTCGAGATGTGGATGCTCATGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145166.2-3014s1c1
Sequence:CCGGCCTGCTTTACTGTAGCTCTTTCTCGAGAAAGAGCTACAGTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-525s1c1
Sequence:CCGGGAAGAAGTTCTCATGCGAGATCTCGAGATCTCGCATGAGAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-693s1c1
Sequence:CCGGGAAGCCGTTCAGATGTGAGAACTCGAGTTCTCACATCTGAACGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145166
ZBTB47 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 47
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145166.3-2170s21c1
Sequence:CCGGAGCCGTACATCTGCGAGATCTCTCGAGAGATCTCGCAGATGTACGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145166.3-485s21c1
Sequence:CCGGGCAGATCCTCAACTTCATCTACTCGAGTAGATGAAGTTGAGGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-489s1c1
Sequence:CCGGCCATGAGCATAACAAGATTGTCTCGAGACAATCTTGTTATGCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-750s1c1
Sequence:CCGGGTCACACATGAGCATCCACATCTCGAGATGTGGATGCTCATGTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107920    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145166.2-3014s1c1
Sequence:CCGGCCTGCTTTACTGTAGCTCTTTCTCGAGAAAGAGCTACAGTAAAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-525s1c1
Sequence:CCGGGAAGAAGTTCTCATGCGAGATCTCGAGATCTCGCATGAGAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145166.2-693s1c1
Sequence:CCGGGAAGCCGTTCAGATGTGAGAACTCGAGTTCTCACATCTGAACGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks