EMAIL THIS PAGE TO A FRIEND

ZBTB48

zinc finger and BTB domain containing 48

Synonyms: HKR3 ZNF855 pp9964
UniProtKB ID: P10074, Q5SY19
Gene ID:
Mouse(100090) zinc finger and BTB domain containing 48
Rat(362668) zinc finger and BTB domain containing 48
Zebrafish(567773) zinc finger and BTB domain containing 48
domestic cat(101092126) zinc finger and BTB domain containing 48
Horse(100059238) zinc finger and BTB domain containing 48
dog(608070) zinc finger and BTB domain containing 48
chicken(419370) zinc finger and BTB domain containing 48
cow(534608) zinc finger and BTB domain containing 48
sheep(101121027) zinc finger and BTB domain containing 48
naked mole-rat(101700978) zinc finger and BTB domain containing 48
Domestic Rabbit(100353186) zinc finger and BTB domain containing 48
domestic guinea pig(100724022) zinc finger and BTB domain containing 48
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102748 Anti-ZBTB48 (ab1) antibody produced in rabbit affinity isolated antibody canine, human, guinea pig, horse, rabbit
western blot pricing
SAB2102749 Anti-ZBTB48 (ab2) antibody produced in rabbit affinity isolated antibody canine, horse, mouse, human, bovine, guinea pig, rabbit, rat
western blot pricing
AV31937 Anti-ZBTB48 antibody produced in rabbit affinity isolated antibody canine, horse, guinea pig, rabbit, mouse, bovine, human, rat
western blot pricing
HPA030417 Anti-ZBTB48 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005341 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005341 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005341 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005341 Rosetta Predictions human pricing
NM_001013216 Rosetta Predictions rat pricing
XM_001075474 Rosetta Predictions rat pricing
XM_001075497 Rosetta Predictions rat pricing
XM_001075544 Rosetta Predictions rat pricing
XM_001076033 Rosetta Predictions rat pricing
XM_001076052 Rosetta Predictions rat pricing
XM_001076097 Rosetta Predictions rat pricing
NM_133879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005341 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199176 predicted 1117
2 SASI_Hs01_00199177 predicted 1525
3 SASI_Hs01_00199178 predicted 918
4 SASI_Hs01_00199179 predicted 1992
5 SASI_Hs01_00199180 predicted 1197
6 SASI_Hs01_00199181 predicted 251
7 SASI_Hs01_00199182 predicted 1727
8 SASI_Hs01_00199183 predicted 1505
9 SASI_Hs01_00199184 predicted 1456
10 SASI_Hs02_00339419 predicted 359
11 SASI_Hs01_00199185 predicted 1433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201008 predicted 1731
2 SASI_Rn02_00201009 predicted 955
3 SASI_Rn02_00201010 predicted 1052
4 SASI_Rn02_00201011 predicted 480
5 SASI_Rn02_00201012 predicted 1803
6 SASI_Rn02_00201013 predicted 1447
7 SASI_Rn02_00201014 predicted 1758
8 SASI_Rn02_00201015 predicted 1120
9 SASI_Rn02_00201016 predicted 1887
10 SASI_Rn02_00201017 predicted 1742
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075474 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349874 predicted 733
2 SASI_Rn02_00349875 predicted 414
3 SASI_Rn02_00349876 predicted 452
4 SASI_Rn02_00349877 predicted 580
5 SASI_Rn02_00349878 predicted 617
6 SASI_Rn02_00349879 predicted 696
7 SASI_Rn02_00349880 predicted 1273
8 SASI_Rn02_00349881 predicted 613
9 SASI_Rn02_00349882 predicted 764
10 SASI_Rn02_00349883 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075497 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349964 predicted 1138
2 SASI_Rn02_00349965 predicted 817
3 SASI_Rn02_00349966 predicted 855
4 SASI_Rn02_00349967 predicted 980
5 SASI_Rn02_00349968 predicted 1020
6 SASI_Rn02_00349969 predicted 1102
7 SASI_Rn02_00349970 predicted 1674
8 SASI_Rn02_00349971 predicted 1018
9 SASI_Rn02_00349972 predicted 1165
10 SASI_Rn02_00349973 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00350165 predicted 798
2 SASI_Rn02_00350166 predicted 870
3 SASI_Rn02_00350167 predicted 511
4 SASI_Rn02_00350168 predicted 672
5 SASI_Rn02_00350169 predicted 266
6 SASI_Rn02_00350170 predicted 794
7 SASI_Rn02_00350171 predicted 1376
8 SASI_Rn02_00350172 predicted 235
9 SASI_Rn02_00350173 predicted 826
10 SASI_Rn02_00350174 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351843 predicted 1654
2 SASI_Rn02_00351844 predicted 884
3 SASI_Rn02_00351845 predicted 974
4 SASI_Rn02_00351846 predicted 414
5 SASI_Rn02_00351847 predicted 1735
6 SASI_Rn02_00351848 predicted 1373
7 SASI_Rn02_00351849 predicted 1695
8 SASI_Rn02_00351850 predicted 1049
9 SASI_Rn02_00351851 predicted 1814
10 SASI_Rn02_00351852 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351917 predicted 2056
2 SASI_Rn02_00351918 predicted 1292
3 SASI_Rn02_00351919 predicted 1378
4 SASI_Rn02_00351920 predicted 813
5 SASI_Rn02_00351921 predicted 2135
6 SASI_Rn02_00351922 predicted 1774
7 SASI_Rn02_00351923 predicted 2092
8 SASI_Rn02_00351924 predicted 1454
9 SASI_Rn02_00351925 predicted 2219
10 SASI_Rn02_00351926 predicted 2075
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00352017 predicted 1752
2 SASI_Rn02_00352018 predicted 988
3 SASI_Rn02_00352019 predicted 1076
4 SASI_Rn02_00352020 predicted 511
5 SASI_Rn02_00352021 predicted 1838
6 SASI_Rn02_00352022 predicted 1466
7 SASI_Rn02_00352023 predicted 1792
8 SASI_Rn02_00352024 predicted 1147
9 SASI_Rn02_00352025 predicted 1907
10 SASI_Rn02_00352026 predicted 1764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052623 predicted 1496
2 SASI_Mm01_00052624 predicted 1070
3 SASI_Mm02_00338935 predicted 864
4 SASI_Mm01_00052625 predicted 1021
5 SASI_Mm02_00338936 predicted 196
6 SASI_Mm01_00052627 predicted 1099
7 SASI_Mm01_00052626 predicted 1466
8 SASI_Mm01_00052629 predicted 1145
9 SASI_Mm01_00052630 predicted 1404
10 SASI_Mm01_00052631 predicted 231
11 SASI_Mm01_00052622 predicted 1164
12 SASI_Mm01_00052628 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005341
VALIDATED
ZBTB48 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 48
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-1307s1c1
Sequence:CCGGCCAGCAGTTCATGCAGAAGAACTCGAGTTCTTCTGCATGAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-1421s1c1
Sequence:CCGGGCAGCTGCATGAAGCTTTCAACTCGAGTTGAAAGCTTCATGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005341.1-1955s1c1
Sequence:CCGGCGACCGGGTAGAGAACTACAACTCGAGTTGTAGTTCTCTACCCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-563s1c1
Sequence:CCGGGAATGTGAACAGCCACGTCAACTCGAGTTGACGTGGCTGTTCACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-916s1c1
Sequence:CCGGCCAGGAGGAAGTCAAATGTAACTCGAGTTACATTTGACTTCCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-355s21c1
Sequence:CCGGCTGGCTTCGCTGAGATCTTTGCTCGAGCAAAGATCTCAGCGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1055s21c1
Sequence:CCGGCCTCAGCAAATATTATCTAAACTCGAGTTTAGATAATATTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-912s21c1
Sequence:CCGGCTGACCAGGAGGAAGTCAAATCTCGAGATTTGACTTCCTCCTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1897s21c1
Sequence:CCGGCCGAGTGTGGCTACAAGTTTACTCGAGTAAACTTGTAGCCACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1119s21c1
Sequence:CCGGCCCAAATGTGGGAAGTGTTACCTCGAGGTAACACTTCCCACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005341
VALIDATED
ZBTB48 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 48
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-1307s1c1
Sequence:CCGGCCAGCAGTTCATGCAGAAGAACTCGAGTTCTTCTGCATGAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-1421s1c1
Sequence:CCGGGCAGCTGCATGAAGCTTTCAACTCGAGTTGAAAGCTTCATGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005341.1-1955s1c1
Sequence:CCGGCGACCGGGTAGAGAACTACAACTCGAGTTGTAGTTCTCTACCCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-563s1c1
Sequence:CCGGGAATGTGAACAGCCACGTCAACTCGAGTTGACGTGGCTGTTCACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-916s1c1
Sequence:CCGGCCAGGAGGAAGTCAAATGTAACTCGAGTTACATTTGACTTCCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-355s21c1
Sequence:CCGGCTGGCTTCGCTGAGATCTTTGCTCGAGCAAAGATCTCAGCGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1055s21c1
Sequence:CCGGCCTCAGCAAATATTATCTAAACTCGAGTTTAGATAATATTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-912s21c1
Sequence:CCGGCTGACCAGGAGGAAGTCAAATCTCGAGATTTGACTTCCTCCTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1897s21c1
Sequence:CCGGCCGAGTGTGGCTACAAGTTTACTCGAGTAAACTTGTAGCCACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1119s21c1
Sequence:CCGGCCCAAATGTGGGAAGTGTTACCTCGAGGTAACACTTCCCACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005341
VALIDATED
ZBTB48 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 48
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-1307s1c1
Sequence:CCGGCCAGCAGTTCATGCAGAAGAACTCGAGTTCTTCTGCATGAACTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-1421s1c1
Sequence:CCGGGCAGCTGCATGAAGCTTTCAACTCGAGTTGAAAGCTTCATGCAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_005341.1-1955s1c1
Sequence:CCGGCGACCGGGTAGAGAACTACAACTCGAGTTGTAGTTCTCTACCCGGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-563s1c1
Sequence:CCGGGAATGTGAACAGCCACGTCAACTCGAGTTGACGTGGCTGTTCACATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005341.1-916s1c1
Sequence:CCGGCCAGGAGGAAGTCAAATGTAACTCGAGTTACATTTGACTTCCTCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-355s21c1
Sequence:CCGGCTGGCTTCGCTGAGATCTTTGCTCGAGCAAAGATCTCAGCGAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1055s21c1
Sequence:CCGGCCTCAGCAAATATTATCTAAACTCGAGTTTAGATAATATTTGCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-912s21c1
Sequence:CCGGCTGACCAGGAGGAAGTCAAATCTCGAGATTTGACTTCCTCCTGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1897s21c1
Sequence:CCGGCCGAGTGTGGCTACAAGTTTACTCGAGTAAACTTGTAGCCACACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005341.1-1119s21c1
Sequence:CCGGCCCAAATGTGGGAAGTGTTACCTCGAGGTAACACTTCCCACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133879
VALIDATED
ZBTB48 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 48
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133879.1-1926s1c1
Sequence:CCGGGCGACACAAAGGTGTGAGAAACTCGAGTTTCTCACACCTTTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-1731s1c1
Sequence:CCGGCCCAAGTTTGGACAAGCACAACTCGAGTTGTGCTTGTCCAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-464s1c1
Sequence:CCGGTGTGGAGCTATGTCAGAGCTTCTCGAGAAGCTCTGACATAGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133879.1-1110s1c1
Sequence:CCGGCGCAAGGAGAATCTCTTGGAACTCGAGTTCCAAGAGATTCTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-283s1c1
Sequence:CCGGGCAGCCATTTCTTCCAGAGAACTCGAGTTCTCTGGAAGAAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-329s21c1
Sequence:CCGGCAGCGGGCTTTGCTGAGATTTCTCGAGAAATCTCAGCAAAGCCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1487s21c1
Sequence:CCGGACAGGAATGAAAGGCCTTATGCTCGAGCATAAGGCCTTTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1142s21c1
Sequence:CCGGACCGCTCAGAACAGGTCTTCACTCGAGTGAAGACCTGTTCTGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133879.2-1062s21c1
Sequence:CCGGACCCTTCGAGTGTCCCAAATGCTCGAGCATTTGGGACACTCGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1013s21c1
Sequence:CCGGTCAGCAAATATTACCTGAAAGCTCGAGCTTTCAGGTAATATTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133879
VALIDATED
ZBTB48 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 48
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133879.1-1926s1c1
Sequence:CCGGGCGACACAAAGGTGTGAGAAACTCGAGTTTCTCACACCTTTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-1731s1c1
Sequence:CCGGCCCAAGTTTGGACAAGCACAACTCGAGTTGTGCTTGTCCAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-464s1c1
Sequence:CCGGTGTGGAGCTATGTCAGAGCTTCTCGAGAAGCTCTGACATAGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133879.1-1110s1c1
Sequence:CCGGCGCAAGGAGAATCTCTTGGAACTCGAGTTCCAAGAGATTCTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-283s1c1
Sequence:CCGGGCAGCCATTTCTTCCAGAGAACTCGAGTTCTCTGGAAGAAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-329s21c1
Sequence:CCGGCAGCGGGCTTTGCTGAGATTTCTCGAGAAATCTCAGCAAAGCCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1487s21c1
Sequence:CCGGACAGGAATGAAAGGCCTTATGCTCGAGCATAAGGCCTTTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1142s21c1
Sequence:CCGGACCGCTCAGAACAGGTCTTCACTCGAGTGAAGACCTGTTCTGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133879.2-1062s21c1
Sequence:CCGGACCCTTCGAGTGTCCCAAATGCTCGAGCATTTGGGACACTCGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1013s21c1
Sequence:CCGGTCAGCAAATATTACCTGAAAGCTCGAGCTTTCAGGTAATATTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133879
VALIDATED
ZBTB48 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 48
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133879.1-1926s1c1
Sequence:CCGGGCGACACAAAGGTGTGAGAAACTCGAGTTTCTCACACCTTTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-1731s1c1
Sequence:CCGGCCCAAGTTTGGACAAGCACAACTCGAGTTGTGCTTGTCCAAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-464s1c1
Sequence:CCGGTGTGGAGCTATGTCAGAGCTTCTCGAGAAGCTCTGACATAGCTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_133879.1-1110s1c1
Sequence:CCGGCGCAAGGAGAATCTCTTGGAACTCGAGTTCCAAGAGATTCTCCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133879.1-283s1c1
Sequence:CCGGGCAGCCATTTCTTCCAGAGAACTCGAGTTCTCTGGAAGAAATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-329s21c1
Sequence:CCGGCAGCGGGCTTTGCTGAGATTTCTCGAGAAATCTCAGCAAAGCCCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1487s21c1
Sequence:CCGGACAGGAATGAAAGGCCTTATGCTCGAGCATAAGGCCTTTCATTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1142s21c1
Sequence:CCGGACCGCTCAGAACAGGTCTTCACTCGAGTGAAGACCTGTTCTGAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_133879.2-1062s21c1
Sequence:CCGGACCCTTCGAGTGTCCCAAATGCTCGAGCATTTGGGACACTCGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321547    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133879.2-1013s21c1
Sequence:CCGGTCAGCAAATATTACCTGAAAGCTCGAGCTTTCAGGTAATATTTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks