EMAIL THIS PAGE TO A FRIEND

ZBTB49

zinc finger and BTB domain containing 49

Synonyms: ZNF509
UniProtKB ID: Q6ZSB9, Q59FJ4, Q5EBN0, Q8TB80
Gene ID:
Mouse(75079) zinc finger and BTB domain containing 49
Rat(305428) zinc finger and BTB domain containing 49
domestic guinea pig(100727470) zinc finger and BTB domain containing 49
naked mole-rat(101705269) zinc finger and BTB domain containing 49
cow(507385) zinc finger and BTB domain containing 49
sheep(101114273) zinc finger and BTB domain containing 49
Zebrafish(100009630) zinc finger and BTB domain containing 49
dog(488826) zinc finger and BTB domain containing 49
chicken(422847) zinc finger and BTB domain containing 49
Horse(100069664) zinc finger and BTB domain containing 49
domestic cat(101088577) zinc finger and BTB domain containing 49
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145291 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145291 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145291 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145291 Rosetta Predictions human pricing
NM_001107223 Rosetta Predictions rat pricing
NM_029162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145291 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231762 predicted 2087
2 SASI_Hs01_00231763 predicted 1339
3 SASI_Hs01_00231764 predicted 1001
4 SASI_Hs01_00231765 predicted 2403
5 SASI_Hs01_00231766 predicted 629
6 SASI_Hs01_00231767 predicted 667
7 SASI_Hs02_00365176 predicted 546
8 SASI_Hs01_00231768 predicted 578
9 SASI_Hs01_00231769 predicted 2317
10 SASI_Hs01_00231770 predicted 382
11 SASI_Hs01_00231771 predicted 1117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226725 predicted 291
2 SASI_Rn02_00226726 predicted 712
3 SASI_Rn02_00226727 predicted 1384
4 SASI_Rn02_00226728 predicted 1263
5 SASI_Rn02_00226729 predicted 1306
6 SASI_Rn02_00226730 predicted 433
7 SASI_Rn02_00226731 predicted 369
8 SASI_Rn02_00226732 predicted 735
9 SASI_Rn02_00226733 predicted 287
10 SASI_Rn02_00226734 predicted 502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023025 predicted 1555
2 SASI_Mm01_00023027 predicted 1267
3 SASI_Mm01_00023029 predicted 1819
4 SASI_Mm01_00023031 predicted 447
5 SASI_Mm02_00334970 predicted 744
6 SASI_Mm01_00023032 predicted 1769
7 SASI_Mm01_00023034 predicted 1604
8 SASI_Mm02_00334971 predicted 1563
9 SASI_Mm02_00334972 predicted 611
10 SASI_Mm02_00334973 predicted 1085
11 SASI_Mm01_00023026 predicted 1568
12 SASI_Mm01_00023028 predicted 1445
13 SASI_Mm01_00023030 predicted 1315
14 SASI_Mm01_00023033 predicted 1290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145291
ZBTB49 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 49
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-220s21c1
Sequence:CCGGAGTCTGCTTTAAAGCGCATAACTCGAGTTATGCGCTTTAAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-1514s21c1
Sequence:CCGGGACGTCCAGCGTCACATTATTCTCGAGAATAATGTGACGCTGGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-1994s21c1
Sequence:CCGGCTGATGCCAGTGTCGGTTAAACTCGAGTTTAACCGACACTGGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-779s21c1
Sequence:CCGGTACAGTAAGCAGTACCATAAACTCGAGTTTATGGTACTGCTTACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145291.2-2543s21c1
Sequence:CCGGTCCTGATGATGGCTCATAATCCTCGAGGATTATGAGCCATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-736s1c1
Sequence:CCGGGCCTTTCAAACAGCCAAATTACTCGAGTAATTTGGCTGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-1307s1c1
Sequence:CCGGGCGTGTGAATTATGCGGGAAACTCGAGTTTCCCGCATAATTCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-645s1c1
Sequence:CCGGCGCATGCTTCACCATCAGTTACTCGAGTAACTGATGGTGAAGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145291.2-2509s1c1
Sequence:CCGGGCCTTCTAACTAGCCAGAGAACTCGAGTTCTCTGGCTAGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-422s1c1
Sequence:CCGGGCACAGTGTTTGCAAGTTCAACTCGAGTTGAACTTGCAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145291
ZBTB49 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 49
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-220s21c1
Sequence:CCGGAGTCTGCTTTAAAGCGCATAACTCGAGTTATGCGCTTTAAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-1514s21c1
Sequence:CCGGGACGTCCAGCGTCACATTATTCTCGAGAATAATGTGACGCTGGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-1994s21c1
Sequence:CCGGCTGATGCCAGTGTCGGTTAAACTCGAGTTTAACCGACACTGGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-779s21c1
Sequence:CCGGTACAGTAAGCAGTACCATAAACTCGAGTTTATGGTACTGCTTACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145291.2-2543s21c1
Sequence:CCGGTCCTGATGATGGCTCATAATCCTCGAGGATTATGAGCCATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-736s1c1
Sequence:CCGGGCCTTTCAAACAGCCAAATTACTCGAGTAATTTGGCTGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-1307s1c1
Sequence:CCGGGCGTGTGAATTATGCGGGAAACTCGAGTTTCCCGCATAATTCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-645s1c1
Sequence:CCGGCGCATGCTTCACCATCAGTTACTCGAGTAACTGATGGTGAAGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145291.2-2509s1c1
Sequence:CCGGGCCTTCTAACTAGCCAGAGAACTCGAGTTCTCTGGCTAGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-422s1c1
Sequence:CCGGGCACAGTGTTTGCAAGTTCAACTCGAGTTGAACTTGCAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145291
ZBTB49 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 49
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-220s21c1
Sequence:CCGGAGTCTGCTTTAAAGCGCATAACTCGAGTTATGCGCTTTAAAGCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-1514s21c1
Sequence:CCGGGACGTCCAGCGTCACATTATTCTCGAGAATAATGTGACGCTGGACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-1994s21c1
Sequence:CCGGCTGATGCCAGTGTCGGTTAAACTCGAGTTTAACCGACACTGGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145291.2-779s21c1
Sequence:CCGGTACAGTAAGCAGTACCATAAACTCGAGTTTATGGTACTGCTTACTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145291.2-2543s21c1
Sequence:CCGGTCCTGATGATGGCTCATAATCCTCGAGGATTATGAGCCATCATCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-736s1c1
Sequence:CCGGGCCTTTCAAACAGCCAAATTACTCGAGTAATTTGGCTGTTTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-1307s1c1
Sequence:CCGGGCGTGTGAATTATGCGGGAAACTCGAGTTTCCCGCATAATTCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-645s1c1
Sequence:CCGGCGCATGCTTCACCATCAGTTACTCGAGTAACTGATGGTGAAGCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145291.2-2509s1c1
Sequence:CCGGGCCTTCTAACTAGCCAGAGAACTCGAGTTCTCTGGCTAGTTAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145291.2-422s1c1
Sequence:CCGGGCACAGTGTTTGCAAGTTCAACTCGAGTTGAACTTGCAAACACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029162
ZBTB49 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 49
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029162.1-2389s1c1
Sequence:CCGGGTCTCGTAACACTAGAGAGAACTCGAGTTCTCTCTAGTGTTACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-215s1c1
Sequence:CCGGCGTCTGCTTCAAAGCACACAACTCGAGTTGTGTGCTTTGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-1433s1c1
Sequence:CCGGGAAGCCATACATCTGTGAAATCTCGAGATTTCACAGATGTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-1553s1c1
Sequence:CCGGCAGCAATTTCAGCAATTTGAACTCGAGTTCAAATTGCTGAAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-257s1c1
Sequence:CCGGCCAGTATTTCAGGAGCCTCTTCTCGAGAAGAGGCTCCTGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029162
ZBTB49 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 49
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029162.1-2389s1c1
Sequence:CCGGGTCTCGTAACACTAGAGAGAACTCGAGTTCTCTCTAGTGTTACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-215s1c1
Sequence:CCGGCGTCTGCTTCAAAGCACACAACTCGAGTTGTGTGCTTTGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-1433s1c1
Sequence:CCGGGAAGCCATACATCTGTGAAATCTCGAGATTTCACAGATGTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-1553s1c1
Sequence:CCGGCAGCAATTTCAGCAATTTGAACTCGAGTTCAAATTGCTGAAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-257s1c1
Sequence:CCGGCCAGTATTTCAGGAGCCTCTTCTCGAGAAGAGGCTCCTGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029162
ZBTB49 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 49
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095654    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029162.1-2389s1c1
Sequence:CCGGGTCTCGTAACACTAGAGAGAACTCGAGTTCTCTCTAGTGTTACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-215s1c1
Sequence:CCGGCGTCTGCTTCAAAGCACACAACTCGAGTTGTGTGCTTTGAAGCAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-1433s1c1
Sequence:CCGGGAAGCCATACATCTGTGAAATCTCGAGATTTCACAGATGTATGGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-1553s1c1
Sequence:CCGGCAGCAATTTCAGCAATTTGAACTCGAGTTCAAATTGCTGAAATTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029162.1-257s1c1
Sequence:CCGGCCAGTATTTCAGGAGCCTCTTCTCGAGAAGAGGCTCCTGAAATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks