EMAIL THIS PAGE TO A FRIEND

ZBTB4

zinc finger and BTB domain containing 4

Synonyms: KAISO-L1 ZNF903
UniProtKB ID: Q9P1Z0, B3KVL6, Q7Z697, Q86XJ4, Q8N4V8
Gene ID:
Mouse(75580) zinc finger and BTB domain containing 4
Rat(287441) zinc finger and BTB domain containing 4
domestic guinea pig(100713820) zinc finger and BTB domain containing 4
naked mole-rat(101724714) zinc finger and BTB domain containing 4
Domestic Rabbit(100356909) zinc finger and BTB domain containing 4
cow(613607) zinc finger and BTB domain containing 4
sheep(101122290) zinc finger and BTB domain containing 4
Zebrafish(798710) zinc finger and BTB domain containing 4
Horse(100072993) zinc finger and BTB domain containing 4
domestic cat(101098266) zinc finger and BTB domain containing 4
dog(489474) zinc finger and BTB domain containing 4
250 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301916 Anti-ZBTB4 affinity isolated antibody human
immunohistochemistry pricing
SAB2104033 Anti-ZBTB4 antibody produced in rabbit affinity isolated antibody guinea pig, horse, canine, rat, rabbit, human, mouse
western blot pricing
SAB3500610 Anti-ZBTB4 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA064763 Anti-ZBTB4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020899 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020899 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020899 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_126150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_029348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020899 Rosetta Predictions human pricing
XM_001079524 Rosetta Predictions rat pricing
XM_220612 Rosetta Predictions rat pricing
NM_029348 Rosetta Predictions mouse pricing
XM_894801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020899 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354225 predicted 3172
2 SASI_Hs01_00186748 predicted 1476
3 SASI_Hs02_00354226 predicted 1373
4 SASI_Hs01_00186750 predicted 3462
5 SASI_Hs01_00186751 predicted 1491
6 SASI_Hs01_00186752 predicted 3075
7 SASI_Hs01_00186754 predicted 1396
8 SASI_Hs01_00186755 predicted 3587
9 SASI_Hs01_00186756 predicted 1482
10 SASI_Hs02_00354227 predicted 3228
11 SASI_Hs01_00186747 predicted 1298
12 SASI_Hs01_00186749 predicted 3600
13 SASI_Hs01_00186753 predicted 1288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079524 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364596 predicted 2883
2 SASI_Rn02_00364597 predicted 1195
3 SASI_Rn02_00364598 predicted 1009
4 SASI_Rn02_00364599 predicted 3392
5 SASI_Rn02_00364600 predicted 1292
6 SASI_Rn02_00364601 predicted 1305
7 SASI_Rn02_00364602 predicted 3306
8 SASI_Rn02_00364603 predicted 803
9 SASI_Rn02_00364604 predicted 2820
10 SASI_Rn02_00364605 predicted 2872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220612 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379436 predicted 2869
2 SASI_Rn02_00379437 predicted 1179
3 SASI_Rn02_00379438 predicted 987
4 SASI_Rn02_00379439 predicted 3375
5 SASI_Rn02_00379440 predicted 1269
6 SASI_Rn02_00379441 predicted 1285
7 SASI_Rn02_00379442 predicted 3287
8 SASI_Rn02_00379443 predicted 790
9 SASI_Rn02_00379444 predicted 2798
10 SASI_Rn02_00379445 predicted 2856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335190 predicted 343
2 SASI_Mm02_00335191 predicted 769
3 SASI_Mm02_00335192 predicted 2560
4 SASI_Mm02_00335193 predicted 901
5 SASI_Mm02_00335194 predicted 1092
6 SASI_Mm02_00335195 predicted 1050
7 SASI_Mm02_00335196 predicted 3593
8 SASI_Mm02_00335197 predicted 872
9 SASI_Mm02_00335198 predicted 2966
10 SASI_Mm02_00335199 predicted 1197
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266098 predicted 2789
2 SASI_Mm01_00266099 predicted 1035
3 SASI_Mm01_00266100 predicted 664
4 SASI_Mm01_00266101 predicted 1090
5 SASI_Mm01_00266102 predicted 2903
6 SASI_Mm01_00266103 predicted 2408
7 SASI_Mm01_00266104 predicted 2401
8 SASI_Mm01_00266105 predicted 2299
9 SASI_Mm01_00266106 predicted 993
10 SASI_Mm01_00266107 predicted 826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020899
VALIDATED
ZBTB4 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1389s1c1
Sequence:CCGGGAGACCTTTGTCACTTACTATCTCGAGATAGTAAGTGACAAAGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1293s1c1
Sequence:CCGGCGCTATTGTGAGAAAGTGTTTCTCGAGAAACACTTTCTCACAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-3174s1c1
Sequence:CCGGGTCTTTGGCTACGCAGTGAATCTCGAGATTCACTGCGTAGCCAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020899.2-3234s1c1
Sequence:CCGGCCAACTCTTCCTCCACCAATTCTCGAGAATTGGTGGAGGAAGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1493s1c1
Sequence:CCGGGCCCAAGCTCAATACACTCAACTCGAGTTGAGTGTATTGAGCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-1440s21c1
Sequence:CCGGGAGACCTTTGTCACTTACTATCTCGAGATAGTAAGTGACAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-1344s21c1
Sequence:CCGGCGCTATTGTGAGAAAGTGTTTCTCGAGAAACACTTTCTCACAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-3225s21c1
Sequence:CCGGGTCTTTGGCTACGCAGTGAATCTCGAGATTCACTGCGTAGCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-3541s21c1
Sequence:CCGGTCTCCTGGGAAGGGATCTTTCCTCGAGGAAAGATCCCTTCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020899.3-1544s21c1
Sequence:CCGGGCCCAAGCTCAATACACTCAACTCGAGTTGAGTGTATTGAGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020899
VALIDATED
ZBTB4 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1389s1c1
Sequence:CCGGGAGACCTTTGTCACTTACTATCTCGAGATAGTAAGTGACAAAGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1293s1c1
Sequence:CCGGCGCTATTGTGAGAAAGTGTTTCTCGAGAAACACTTTCTCACAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-3174s1c1
Sequence:CCGGGTCTTTGGCTACGCAGTGAATCTCGAGATTCACTGCGTAGCCAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020899.2-3234s1c1
Sequence:CCGGCCAACTCTTCCTCCACCAATTCTCGAGAATTGGTGGAGGAAGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1493s1c1
Sequence:CCGGGCCCAAGCTCAATACACTCAACTCGAGTTGAGTGTATTGAGCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-1440s21c1
Sequence:CCGGGAGACCTTTGTCACTTACTATCTCGAGATAGTAAGTGACAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-1344s21c1
Sequence:CCGGCGCTATTGTGAGAAAGTGTTTCTCGAGAAACACTTTCTCACAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-3225s21c1
Sequence:CCGGGTCTTTGGCTACGCAGTGAATCTCGAGATTCACTGCGTAGCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-3541s21c1
Sequence:CCGGTCTCCTGGGAAGGGATCTTTCCTCGAGGAAAGATCCCTTCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020899.3-1544s21c1
Sequence:CCGGGCCCAAGCTCAATACACTCAACTCGAGTTGAGTGTATTGAGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020899
VALIDATED
ZBTB4 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1389s1c1
Sequence:CCGGGAGACCTTTGTCACTTACTATCTCGAGATAGTAAGTGACAAAGGTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1293s1c1
Sequence:CCGGCGCTATTGTGAGAAAGTGTTTCTCGAGAAACACTTTCTCACAATAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-3174s1c1
Sequence:CCGGGTCTTTGGCTACGCAGTGAATCTCGAGATTCACTGCGTAGCCAAAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020899.2-3234s1c1
Sequence:CCGGCCAACTCTTCCTCCACCAATTCTCGAGAATTGGTGGAGGAAGAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020899.2-1493s1c1
Sequence:CCGGGCCCAAGCTCAATACACTCAACTCGAGTTGAGTGTATTGAGCTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-1440s21c1
Sequence:CCGGGAGACCTTTGTCACTTACTATCTCGAGATAGTAAGTGACAAAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-1344s21c1
Sequence:CCGGCGCTATTGTGAGAAAGTGTTTCTCGAGAAACACTTTCTCACAATAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-3225s21c1
Sequence:CCGGGTCTTTGGCTACGCAGTGAATCTCGAGATTCACTGCGTAGCCAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280406    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_020899.3-3541s21c1
Sequence:CCGGTCTCCTGGGAAGGGATCTTTCCTCGAGGAAAGATCCCTTCCCAGGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280404    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020899.3-1544s21c1
Sequence:CCGGGCCCAAGCTCAATACACTCAACTCGAGTTGAGTGTATTGAGCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126150
ZBTB4 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 4
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000188798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-740s1c1
Sequence:CCGGGAAGGAGGTGATACTTGGGTACTCGAGTACCCAAGTATCACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-2184s1c1
Sequence:CCGGCCTACTATTCATACAAGCCTACTCGAGTAGGCTTGTATGAATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-614s1c1
Sequence:CCGGGATGTCCTCAACTTCATCTATCTCGAGATAGATGAAGTTGAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-1993s1c1
Sequence:CCGGGTGTCAGATCACTGTGCGAATCTCGAGATTCGCACAGTGATCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126150
ZBTB4 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 4
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000188798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-740s1c1
Sequence:CCGGGAAGGAGGTGATACTTGGGTACTCGAGTACCCAAGTATCACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-2184s1c1
Sequence:CCGGCCTACTATTCATACAAGCCTACTCGAGTAGGCTTGTATGAATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-614s1c1
Sequence:CCGGGATGTCCTCAACTTCATCTATCTCGAGATAGATGAAGTTGAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-1993s1c1
Sequence:CCGGGTGTCAGATCACTGTGCGAATCTCGAGATTCGCACAGTGATCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126150
ZBTB4 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 4
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000188798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-740s1c1
Sequence:CCGGGAAGGAGGTGATACTTGGGTACTCGAGTACCCAAGTATCACCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186898    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-2184s1c1
Sequence:CCGGCCTACTATTCATACAAGCCTACTCGAGTAGGCTTGTATGAATAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-614s1c1
Sequence:CCGGGATGTCCTCAACTTCATCTATCTCGAGATAGATGAAGTTGAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_126150.2-1993s1c1
Sequence:CCGGGTGTCAGATCACTGTGCGAATCTCGAGATTCGCACAGTGATCTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029348
ZBTB4 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 4
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1329s21c1
Sequence:CCGGAGCGAGCCTTCCATGGCATTACTCGAGTAATGCCATGGAAGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-2560s21c1
Sequence:CCGGCACACCTGTCATTGCCTATTCCTCGAGGAATAGGCAATGACAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1294s21c1
Sequence:CCGGCACCTTTGTCACCTATTATAACTCGAGTTATAATAGGTGACAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1390s21c1
Sequence:CCGGCTACAAACCCAGGCTTAATACCTCGAGGTATTAAGCCTGGGTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029348.2-5669s21c1
Sequence:CCGGAGAGAATCTGACCACTATTTACTCGAGTAAATAGTGGTCAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029348.2-5763s1c1
Sequence:CCGGGGATGCCAGATGCGATCATTTCTCGAGAAATGATCGCATCTGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029348
ZBTB4 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 4
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1329s21c1
Sequence:CCGGAGCGAGCCTTCCATGGCATTACTCGAGTAATGCCATGGAAGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-2560s21c1
Sequence:CCGGCACACCTGTCATTGCCTATTCCTCGAGGAATAGGCAATGACAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1294s21c1
Sequence:CCGGCACCTTTGTCACCTATTATAACTCGAGTTATAATAGGTGACAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1390s21c1
Sequence:CCGGCTACAAACCCAGGCTTAATACCTCGAGGTATTAAGCCTGGGTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029348.2-5669s21c1
Sequence:CCGGAGAGAATCTGACCACTATTTACTCGAGTAAATAGTGGTCAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029348.2-5763s1c1
Sequence:CCGGGGATGCCAGATGCGATCATTTCTCGAGAAATGATCGCATCTGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029348
ZBTB4 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 4
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1329s21c1
Sequence:CCGGAGCGAGCCTTCCATGGCATTACTCGAGTAATGCCATGGAAGGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-2560s21c1
Sequence:CCGGCACACCTGTCATTGCCTATTCCTCGAGGAATAGGCAATGACAGGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1294s21c1
Sequence:CCGGCACCTTTGTCACCTATTATAACTCGAGTTATAATAGGTGACAAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029348.2-1390s21c1
Sequence:CCGGCTACAAACCCAGGCTTAATACCTCGAGGTATTAAGCCTGGGTTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245399    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029348.2-5669s21c1
Sequence:CCGGAGAGAATCTGACCACTATTTACTCGAGTAAATAGTGGTCAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219593    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_029348.2-5763s1c1
Sequence:CCGGGGATGCCAGATGCGATCATTTCTCGAGAAATGATCGCATCTGGCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks