EMAIL THIS PAGE TO A FRIEND

ZBTB5

zinc finger and BTB domain containing 5

UniProtKB ID: O15062
Gene ID:
Mouse(230119) zinc finger and BTB domain containing 5
Rat(298084) zinc finger and BTB domain containing 5
chicken(431260) zinc finger and BTB domain containing 5
domestic cat(101101094) zinc finger and BTB domain containing 5
Horse(100066548) zinc finger and BTB domain containing 5
dog(481612) zinc finger and BTB domain containing 5
cow(518910) zinc finger and BTB domain containing 5
sheep(101107930) zinc finger and BTB domain containing 5
naked mole-rat(101702574) zinc finger and BTB domain containing 5
domestic guinea pig(100713378) zinc finger and BTB domain containing 5
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017371 MISSION® esiRNA esiRNA targeting human ZBTB5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014872 Rosetta Predictions human pricing
NM_001106657 Rosetta Predictions rat pricing
NM_173399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346475 predicted 1378
2 SASI_Hs01_00183643 predicted 956
3 SASI_Hs01_00183644 predicted 423
4 SASI_Hs02_00346476 predicted 506
5 SASI_Hs01_00183646 predicted 1812
6 SASI_Hs01_00183647 predicted 2047
7 SASI_Hs01_00183648 predicted 2254
8 SASI_Hs02_00346477 predicted 2216
9 SASI_Hs01_00183649 predicted 1684
10 SASI_Hs01_00183650 predicted 2070
11 SASI_Hs01_00183642 predicted 2152
12 SASI_Hs01_00183645 predicted 1976
13 SASI_Hs01_00183651 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106657 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221108 predicted 842
2 SASI_Rn02_00221109 predicted 388
3 SASI_Rn02_00221110 predicted 1363
4 SASI_Rn02_00221111 predicted 1768
5 SASI_Rn02_00221112 predicted 1953
6 SASI_Rn02_00221113 predicted 1668
7 SASI_Rn02_00221114 predicted 339
8 SASI_Rn02_00221115 predicted 229
9 SASI_Rn02_00221116 predicted 1962
10 SASI_Rn02_00221117 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033756 predicted 288
2 SASI_Mm01_00033757 predicted 1609
3 SASI_Mm01_00033758 predicted 1205
4 SASI_Mm01_00033759 predicted 326
5 SASI_Mm01_00033760 predicted 1994
6 SASI_Mm01_00033761 predicted 736
7 SASI_Mm01_00033762 predicted 813
8 SASI_Mm01_00033763 predicted 376
9 SASI_Mm01_00033764 predicted 1805
10 SASI_Mm01_00033765 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014872
VALIDATED
ZBTB5 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 5
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014872.1-945s1c1
Sequence:CCGGCCAGGAAGATAGTGCGATCATCTCGAGATGATCGCACTATCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014872.1-255s1c1
Sequence:CCGGGCTCTGTGATTGTGTCATTGTCTCGAGACAATGACACAATCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014872.1-2252s1c1
Sequence:CCGGGCCAGTTGTCAGACTGAATTTCTCGAGAAATTCAGTCTGACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014872.1-958s1c1
Sequence:CCGGGCGATCATGTTTGATCAGTCTCTCGAGAGACTGATCAAACATGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014872.1-516s1c1
Sequence:CCGGCTCTGTTGTTAAGGCATGTAACTCGAGTTACATGCCTTAACAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014872.1-812s1c1
Sequence:CCGGCCATAGATGAGTCTGCCATTTCTCGAGAAATGGCAGACTCATCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014872.1-4204s1c1
Sequence:CCGGGCTGAAGCATAAGTGGACTTTCTCGAGAAAGTCCACTTATGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-1363s21c1
Sequence:CCGGGGGTAGGTGATATCCATATTTCTCGAGAAATATGGATATCACCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014872.2-2593s21c1
Sequence:CCGGACCTTCTGATGGGAGTATTATCTCGAGATAATACTCCCATCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014872.2-2020s21c1
Sequence:CCGGTAGAGGGAGCTCGCAAGTATGCTCGAGCATACTTGCGAGCTCCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-538s21c1
Sequence:CCGGAGGCATGTAAACATTACTTAACTCGAGTTAAGTAATGTTTACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-658s21c1
Sequence:CCGGTCGTGAGCTCAGCCCTCAATTCTCGAGAATTGAGGGCTGAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014872
VALIDATED
ZBTB5 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 5
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014872.1-945s1c1
Sequence:CCGGCCAGGAAGATAGTGCGATCATCTCGAGATGATCGCACTATCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014872.1-255s1c1
Sequence:CCGGGCTCTGTGATTGTGTCATTGTCTCGAGACAATGACACAATCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014872.1-2252s1c1
Sequence:CCGGGCCAGTTGTCAGACTGAATTTCTCGAGAAATTCAGTCTGACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014872.1-958s1c1
Sequence:CCGGGCGATCATGTTTGATCAGTCTCTCGAGAGACTGATCAAACATGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014872.1-516s1c1
Sequence:CCGGCTCTGTTGTTAAGGCATGTAACTCGAGTTACATGCCTTAACAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014872.1-812s1c1
Sequence:CCGGCCATAGATGAGTCTGCCATTTCTCGAGAAATGGCAGACTCATCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014872.1-4204s1c1
Sequence:CCGGGCTGAAGCATAAGTGGACTTTCTCGAGAAAGTCCACTTATGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-1363s21c1
Sequence:CCGGGGGTAGGTGATATCCATATTTCTCGAGAAATATGGATATCACCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014872.2-2593s21c1
Sequence:CCGGACCTTCTGATGGGAGTATTATCTCGAGATAATACTCCCATCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014872.2-2020s21c1
Sequence:CCGGTAGAGGGAGCTCGCAAGTATGCTCGAGCATACTTGCGAGCTCCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-538s21c1
Sequence:CCGGAGGCATGTAAACATTACTTAACTCGAGTTAAGTAATGTTTACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-658s21c1
Sequence:CCGGTCGTGAGCTCAGCCCTCAATTCTCGAGAATTGAGGGCTGAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014872
VALIDATED
ZBTB5 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 5
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014872.1-945s1c1
Sequence:CCGGCCAGGAAGATAGTGCGATCATCTCGAGATGATCGCACTATCTTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137350    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014872.1-255s1c1
Sequence:CCGGGCTCTGTGATTGTGTCATTGTCTCGAGACAATGACACAATCACAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137283    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014872.1-2252s1c1
Sequence:CCGGGCCAGTTGTCAGACTGAATTTCTCGAGAAATTCAGTCTGACAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136728    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014872.1-958s1c1
Sequence:CCGGGCGATCATGTTTGATCAGTCTCTCGAGAGACTGATCAAACATGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014872.1-516s1c1
Sequence:CCGGCTCTGTTGTTAAGGCATGTAACTCGAGTTACATGCCTTAACAACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014872.1-812s1c1
Sequence:CCGGCCATAGATGAGTCTGCCATTTCTCGAGAAATGGCAGACTCATCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137377    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014872.1-4204s1c1
Sequence:CCGGGCTGAAGCATAAGTGGACTTTCTCGAGAAAGTCCACTTATGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-1363s21c1
Sequence:CCGGGGGTAGGTGATATCCATATTTCTCGAGAAATATGGATATCACCTACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330242    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014872.2-2593s21c1
Sequence:CCGGACCTTCTGATGGGAGTATTATCTCGAGATAATACTCCCATCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014872.2-2020s21c1
Sequence:CCGGTAGAGGGAGCTCGCAAGTATGCTCGAGCATACTTGCGAGCTCCCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-538s21c1
Sequence:CCGGAGGCATGTAAACATTACTTAACTCGAGTTAAGTAATGTTTACATGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014872.2-658s21c1
Sequence:CCGGTCGTGAGCTCAGCCCTCAATTCTCGAGAATTGAGGGCTGAGCTCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173399
ZBTB5 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1212s1c1
Sequence:CCGGCCACATCTTGGAAGTCACGAACTCGAGTTCGTGACTTCCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1992s1c1
Sequence:CCGGCCACCTATATAAACACTCGAACTCGAGTTCGAGTGTTTATATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1626s1c1
Sequence:CCGGCTTTCCATATTACCGACGAATCTCGAGATTCGTCGGTAATATGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-286s1c1
Sequence:CCGGGCCCTGATTGACATGATGTATCTCGAGATACATCATGTCAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173399.2-3262s1c1
Sequence:CCGGCCCAGGAGAATAGCACAGTTTCTCGAGAAACTGTGCTATTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173399
ZBTB5 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1212s1c1
Sequence:CCGGCCACATCTTGGAAGTCACGAACTCGAGTTCGTGACTTCCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1992s1c1
Sequence:CCGGCCACCTATATAAACACTCGAACTCGAGTTCGAGTGTTTATATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1626s1c1
Sequence:CCGGCTTTCCATATTACCGACGAATCTCGAGATTCGTCGGTAATATGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-286s1c1
Sequence:CCGGGCCCTGATTGACATGATGTATCTCGAGATACATCATGTCAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173399.2-3262s1c1
Sequence:CCGGCCCAGGAGAATAGCACAGTTTCTCGAGAAACTGTGCTATTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173399
ZBTB5 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1212s1c1
Sequence:CCGGCCACATCTTGGAAGTCACGAACTCGAGTTCGTGACTTCCAAGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1992s1c1
Sequence:CCGGCCACCTATATAAACACTCGAACTCGAGTTCGAGTGTTTATATAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-1626s1c1
Sequence:CCGGCTTTCCATATTACCGACGAATCTCGAGATTCGTCGGTAATATGGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173399.2-286s1c1
Sequence:CCGGGCCCTGATTGACATGATGTATCTCGAGATACATCATGTCAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126219    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173399.2-3262s1c1
Sequence:CCGGCCCAGGAGAATAGCACAGTTTCTCGAGAAACTGTGCTATTCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks