EMAIL THIS PAGE TO A FRIEND

ZBTB6

zinc finger and BTB domain containing 6

Synonyms: ZID ZNF482
UniProtKB ID: Q15916, A8K8N6
Gene ID:
Mouse(241322) zinc finger and BTB domain containing 6
Rat(366029) zinc finger and BTB domain containing 6
domestic guinea pig(100713377) zinc finger and BTB domain containing 6
naked mole-rat(101726397) zinc finger and BTB domain containing 6
Domestic Rabbit(100353211) zinc finger and BTB domain containing 6
cow(540218) zinc finger and BTB domain containing 6
sheep(101110662) zinc finger and BTB domain containing 6
chicken(417108) zinc finger and BTB domain containing 6
dog(491343) zinc finger and BTB domain containing 6
Horse(100067456) zinc finger and BTB domain containing 6
domestic cat(101100928) zinc finger and BTB domain containing 6
162 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006626 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006626 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006626 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006626 Rosetta Predictions human pricing
NM_001108953 Rosetta Predictions rat pricing
NM_146253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006626 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010162 predicted 1385
2 SASI_Hs01_00010163 predicted 554
3 SASI_Hs02_00341971 predicted 308
4 SASI_Hs01_00010164 predicted 627
5 SASI_Hs01_00010165 predicted 887
6 SASI_Hs01_00010166 predicted 1241
7 SASI_Hs01_00010167 predicted 830
8 SASI_Hs01_00010168 predicted 705
9 SASI_Hs01_00010169 predicted 1229
10 SASI_Hs01_00010170 predicted 740
11 SASI_Hs01_00010161 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243714 predicted 555
2 SASI_Rn02_00243715 predicted 815
3 SASI_Rn02_00243716 predicted 1131
4 SASI_Rn02_00243717 predicted 750
5 SASI_Rn02_00243718 predicted 1114
6 SASI_Rn02_00243719 predicted 829
7 SASI_Rn02_00243720 predicted 300
8 SASI_Rn02_00243721 predicted 925
9 SASI_Rn02_00243722 predicted 341
10 SASI_Rn02_00243723 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133801 predicted 790
2 SASI_Mm01_00133802 predicted 1157
3 SASI_Mm01_00133803 predicted 275
4 SASI_Mm01_00133804 predicted 226
5 SASI_Mm01_00133805 predicted 815
6 SASI_Mm01_00133806 predicted 1201
7 SASI_Mm01_00133807 predicted 927
8 SASI_Mm01_00133808 predicted 633
9 SASI_Mm01_00133809 predicted 1217
10 SASI_Mm01_00133810 predicted 528
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006626
ZBTB6 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 6
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-962s21c1
Sequence:CCGGGAATCTGGAGGAAGGTTATTCCTCGAGGAATAACCTTCCTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-596s21c1
Sequence:CCGGTAGTCCTGTAAACATAGATTTCTCGAGAAATCTATGTTTACAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-740s21c1
Sequence:CCGGTTGTATCCTTCATGTAGAATCCTCGAGGATTCTACATGAAGGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-842s21c1
Sequence:CCGGACAGCATTCATTGATCAATTCCTCGAGGAATTGATCAATGAATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-704s21c1
Sequence:CCGGGTCTACAGTAGACATAGGTTTCTCGAGAAACCTATGTCTACTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-295s21c1
Sequence:CCGGATGTCAGAATCACCATCTTACCTCGAGGTAAGATGGTGATTCTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-1067s21c1
Sequence:CCGGCTTATGCTTACAGTGCGGAAACTCGAGTTTCCGCACTGTAAGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-561s21c1
Sequence:CCGGGATAAAGACTGTGAGATAATTCTCGAGAATTATCTCACAGTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006626.4-1607s21c1
Sequence:CCGGATAGTGTTCCTCTCTTATATACTCGAGTATATAAGAGAGGAACACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-1166s1c1
Sequence:CCGGCTTGAAGACATTTACTGCCAACTCGAGTTGGCAGTAAATGTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006626.3-1409s1c1
Sequence:CCGGCGCAAGTCTTTCTGTAGAGATCTCGAGATCTCTACAGAAAGACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-420s1c1
Sequence:CCGGCAGATGGTTCACATTGTGGAACTCGAGTTCCACAATGTGAACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-453s1c1
Sequence:CCGGGCTTTGTCAAAGTATCTGGAACTCGAGTTCCAGATACTTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006626.3-1241s1c1
Sequence:CCGGCCACTGTTGTGATATGGATTTCTCGAGAAATCCATATCACAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006626.3-294s1c1
Sequence:CCGGCATGTCAGAATCACCATCTTACTCGAGTAAGATGGTGATTCTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006626.3-3104s1c1
Sequence:CCGGCCGACTTCATAACCCAATGTTCTCGAGAACATTGGGTTATGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006626
ZBTB6 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 6
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-962s21c1
Sequence:CCGGGAATCTGGAGGAAGGTTATTCCTCGAGGAATAACCTTCCTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-596s21c1
Sequence:CCGGTAGTCCTGTAAACATAGATTTCTCGAGAAATCTATGTTTACAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-740s21c1
Sequence:CCGGTTGTATCCTTCATGTAGAATCCTCGAGGATTCTACATGAAGGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-842s21c1
Sequence:CCGGACAGCATTCATTGATCAATTCCTCGAGGAATTGATCAATGAATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-704s21c1
Sequence:CCGGGTCTACAGTAGACATAGGTTTCTCGAGAAACCTATGTCTACTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-295s21c1
Sequence:CCGGATGTCAGAATCACCATCTTACCTCGAGGTAAGATGGTGATTCTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-1067s21c1
Sequence:CCGGCTTATGCTTACAGTGCGGAAACTCGAGTTTCCGCACTGTAAGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-561s21c1
Sequence:CCGGGATAAAGACTGTGAGATAATTCTCGAGAATTATCTCACAGTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006626.4-1607s21c1
Sequence:CCGGATAGTGTTCCTCTCTTATATACTCGAGTATATAAGAGAGGAACACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-1166s1c1
Sequence:CCGGCTTGAAGACATTTACTGCCAACTCGAGTTGGCAGTAAATGTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006626.3-1409s1c1
Sequence:CCGGCGCAAGTCTTTCTGTAGAGATCTCGAGATCTCTACAGAAAGACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-420s1c1
Sequence:CCGGCAGATGGTTCACATTGTGGAACTCGAGTTCCACAATGTGAACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-453s1c1
Sequence:CCGGGCTTTGTCAAAGTATCTGGAACTCGAGTTCCAGATACTTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006626.3-1241s1c1
Sequence:CCGGCCACTGTTGTGATATGGATTTCTCGAGAAATCCATATCACAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006626.3-294s1c1
Sequence:CCGGCATGTCAGAATCACCATCTTACTCGAGTAAGATGGTGATTCTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006626.3-3104s1c1
Sequence:CCGGCCGACTTCATAACCCAATGTTCTCGAGAACATTGGGTTATGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006626
ZBTB6 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 6
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-962s21c1
Sequence:CCGGGAATCTGGAGGAAGGTTATTCCTCGAGGAATAACCTTCCTCCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-596s21c1
Sequence:CCGGTAGTCCTGTAAACATAGATTTCTCGAGAAATCTATGTTTACAGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-740s21c1
Sequence:CCGGTTGTATCCTTCATGTAGAATCCTCGAGGATTCTACATGAAGGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-842s21c1
Sequence:CCGGACAGCATTCATTGATCAATTCCTCGAGGAATTGATCAATGAATGCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-704s21c1
Sequence:CCGGGTCTACAGTAGACATAGGTTTCTCGAGAAACCTATGTCTACTGTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-295s21c1
Sequence:CCGGATGTCAGAATCACCATCTTACCTCGAGGTAAGATGGTGATTCTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-1067s21c1
Sequence:CCGGCTTATGCTTACAGTGCGGAAACTCGAGTTTCCGCACTGTAAGCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426408    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006626.4-561s21c1
Sequence:CCGGGATAAAGACTGTGAGATAATTCTCGAGAATTATCTCACAGTCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006626.4-1607s21c1
Sequence:CCGGATAGTGTTCCTCTCTTATATACTCGAGTATATAAGAGAGGAACACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-1166s1c1
Sequence:CCGGCTTGAAGACATTTACTGCCAACTCGAGTTGGCAGTAAATGTCTTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149867    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006626.3-1409s1c1
Sequence:CCGGCGCAAGTCTTTCTGTAGAGATCTCGAGATCTCTACAGAAAGACTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-420s1c1
Sequence:CCGGCAGATGGTTCACATTGTGGAACTCGAGTTCCACAATGTGAACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006626.3-453s1c1
Sequence:CCGGGCTTTGTCAAAGTATCTGGAACTCGAGTTCCAGATACTTTGACAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146690    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006626.3-1241s1c1
Sequence:CCGGCCACTGTTGTGATATGGATTTCTCGAGAAATCCATATCACAACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006626.3-294s1c1
Sequence:CCGGCATGTCAGAATCACCATCTTACTCGAGTAAGATGGTGATTCTGACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006626.3-3104s1c1
Sequence:CCGGCCGACTTCATAACCCAATGTTCTCGAGAACATTGGGTTATGAAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146253
VALIDATED
ZBTB6 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1578s21c1
Sequence:CCGGTCCTCTGTTCAGGAGTAATTGCTCGAGCAATTACTCCTGAACAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1696s21c1
Sequence:CCGGGTGTTGCACATCGCTATTAATCTCGAGATTAATAGCGATGTGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1627s21c1
Sequence:CCGGGTGATTTATTGTTGACCTATACTCGAGTATAGGTCAACAATAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146253.3-2511s1c1
Sequence:CCGGCCACCCTTTCTAACTCTAAATCTCGAGATTTAGAGTTAGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146253.3-781s1c1
Sequence:CCGGCCTCATCCAAAGCAGGCATATCTCGAGATATGCCTGCTTTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146253.3-573s1c1
Sequence:CCGGCCTGTAAACCTAGATTTCCATCTCGAGATGGAAATCTAGGTTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146253.3-1013s1c1
Sequence:CCGGGCGACACCTTAAGATGCATAACTCGAGTTATGCATCTTAAGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146253.3-1308s1c1
Sequence:CCGGCCTGATCTCAAACGGCAGAATCTCGAGATTCTGCCGTTTGAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146253
VALIDATED
ZBTB6 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1578s21c1
Sequence:CCGGTCCTCTGTTCAGGAGTAATTGCTCGAGCAATTACTCCTGAACAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1696s21c1
Sequence:CCGGGTGTTGCACATCGCTATTAATCTCGAGATTAATAGCGATGTGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1627s21c1
Sequence:CCGGGTGATTTATTGTTGACCTATACTCGAGTATAGGTCAACAATAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146253.3-2511s1c1
Sequence:CCGGCCACCCTTTCTAACTCTAAATCTCGAGATTTAGAGTTAGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146253.3-781s1c1
Sequence:CCGGCCTCATCCAAAGCAGGCATATCTCGAGATATGCCTGCTTTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146253.3-573s1c1
Sequence:CCGGCCTGTAAACCTAGATTTCCATCTCGAGATGGAAATCTAGGTTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146253.3-1013s1c1
Sequence:CCGGGCGACACCTTAAGATGCATAACTCGAGTTATGCATCTTAAGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146253.3-1308s1c1
Sequence:CCGGCCTGATCTCAAACGGCAGAATCTCGAGATTCTGCCGTTTGAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146253
VALIDATED
ZBTB6 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1578s21c1
Sequence:CCGGTCCTCTGTTCAGGAGTAATTGCTCGAGCAATTACTCCTGAACAGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424416    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1696s21c1
Sequence:CCGGGTGTTGCACATCGCTATTAATCTCGAGATTAATAGCGATGTGCAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421511    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146253.5-1627s21c1
Sequence:CCGGGTGATTTATTGTTGACCTATACTCGAGTATAGGTCAACAATAAATCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146253.3-2511s1c1
Sequence:CCGGCCACCCTTTCTAACTCTAAATCTCGAGATTTAGAGTTAGAAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146253.3-781s1c1
Sequence:CCGGCCTCATCCAAAGCAGGCATATCTCGAGATATGCCTGCTTTGGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146253.3-573s1c1
Sequence:CCGGCCTGTAAACCTAGATTTCCATCTCGAGATGGAAATCTAGGTTTACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146253.3-1013s1c1
Sequence:CCGGGCGACACCTTAAGATGCATAACTCGAGTTATGCATCTTAAGGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146253.3-1308s1c1
Sequence:CCGGCCTGATCTCAAACGGCAGAATCTCGAGATTCTGCCGTTTGAGATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks