EMAIL THIS PAGE TO A FRIEND

ZBTB7A

zinc finger and BTB domain containing 7A

Synonyms: FBI-1 FBI1 LRF ZBTB7 ZNF857A pokemon
UniProtKB ID: O95365, D6W619, O00456, Q14D41, Q5XG86
Gene ID:
Mouse(16969) zinc finger and BTB domain containing 7a
Rat(117107) zinc finger and BTB domain containing 7a
Zebrafish(565670) zinc finger and BTB domain containing 7a
dog(485048) zinc finger and BTB domain containing 7A
chicken(395411) zinc finger and BTB domain containing 7A
cow(788491) zinc finger and BTB domain containing 7A
sheep(101116143) zinc finger and BTB domain containing 7A
naked mole-rat(101708175) zinc finger and BTB domain containing 7A
domestic guinea pig(100729401) zinc finger and BTB domain containing 7A
116 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
F9429 Anti-FBI-1/Pokemon (C-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunoprecipitation, microarray, western blot pricing
F9304 Anti-FBI-1/Pokemon antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunoprecipitation, western blot pricing
AV35899 Anti-ZBTB7A (AB1) antibody produced in rabbit IgG fraction of antiserum rat, bovine, mouse, human, canine
western blot pricing
AV37084 Anti-ZBTB7A (AB2) antibody produced in rabbit IgG fraction of antiserum mouse, rat
western blot pricing
SAB2108264 Anti-ZBTB7A antibody produced in rabbit affinity isolated antibody mouse, guinea pig, bovine, canine, rabbit, human, rat
immunohistochemistry, western blot pricing
SAB2102750 Anti-ZBTB7A antibody produced in rabbit affinity isolated antibody mouse, bovine, rat, canine, human, guinea pig
western blot pricing
HPA046387 Anti-ZBTB7A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500613 Anti-ZBTB7A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2106461 Anti-ZBTB7A antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig
ELISA, western blot pricing
SAB2103082 Anti-ZBTB7A, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder bovine, human, mouse, rat, rabbit, chicken, canine,
western blot pricing
SAB1403244 Monoclonal Anti-ZBTB7A antibody produced in mouse clone 2A2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015898 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015898 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015898 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU085921 MISSION® esiRNA esiRNA targeting mouse Zbtb7a (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015898 Rosetta Predictions human pricing
NM_054002 Rosetta Predictions rat pricing
NM_010731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244764 predicted 404
2 SASI_Hs01_00244765 predicted 393
3 SASI_Hs01_00244766 predicted 400
4 SASI_Hs01_00244767 predicted 403
5 SASI_Hs01_00244768 predicted 2371
6 SASI_Hs02_00348486 predicted 2397
7 SASI_Hs01_00244769 predicted 206
8 SASI_Hs01_00244770 predicted 2373
9 SASI_Hs01_00244771 predicted 2358
10 SASI_Hs01_00244772 predicted 615
11 SASI_Hs01_00244773 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036246 predicted 2180
2 SASI_Rn01_00036249 predicted 2087
3 SASI_Rn01_00036250 predicted 1180
4 SASI_Rn01_00036251 predicted 2159
5 SASI_Rn01_00036252 predicted 2155
6 SASI_Rn01_00036253 predicted 895
7 SASI_Rn02_00267004 predicted 1348
8 SASI_Rn01_00036254 predicted 1278
9 SASI_Rn02_00267005 predicted 222
10 SASI_Rn02_00267006 predicted 587
11 SASI_Rn01_00036245 predicted 1339
12 SASI_Rn01_00036247 predicted 388
13 SASI_Rn01_00036248 predicted 1449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319229 predicted 1759
2 SASI_Mm02_00319230 predicted 822
3 SASI_Mm02_00319231 predicted 1569
4 SASI_Mm01_00198670 predicted 1356
5 SASI_Mm01_00198671 predicted 684
6 SASI_Mm02_00319232 predicted 633
7 SASI_Mm02_00319233 predicted 618
8 SASI_Mm02_00319234 predicted 899
9 SASI_Mm02_00319235 predicted 1586
10 SASI_Mm01_00198674 predicted 489
11 SASI_Mm01_00198668 predicted 828
12 SASI_Mm01_00198669 predicted 700
13 SASI_Mm01_00198672 predicted 1589
14 SASI_Mm01_00198673 predicted 2369
15 SASI_Mm01_00198675 predicted 679
16 SASI_Mm01_00198676 predicted 895
17 SASI_Mm01_00198677 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015898
ZBTB7A MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 7A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-319s1c1
Sequence:CCGGGCCAGTACTTCAAGAAGCTGTCTCGAGACAGCTTCTTGAAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-320s1c1
Sequence:CCGGCCAGTACTTCAAGAAGCTGTTCTCGAGAACAGCTTCTTGAAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015898.2-3928s1c1
Sequence:CCGGCCGTTTGCATATGCAATGCTACTCGAGTAGCATTGCATATGCAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015898.2-2562s1c1
Sequence:CCGGCCACTGAGACACAAACCTATTCTCGAGAATAGGTTTGTGTCTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-578s1c1
Sequence:CCGGGCTGGACCTTGTAGATCAAATCTCGAGATTTGATCTACAAGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-793s1c1
Sequence:CCGGGCAACGGCTTAGACTTCTATGCTCGAGCATAGAAGTCTAAGCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-368s1c1
Sequence:CCGGGAACGTGTACGAGATCGACTTCTCGAGAAGTCGATCTCGTACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-1259s1c1
Sequence:CCGGGCAGAAGGTGGAGAAGAAGATCTCGAGATCTTCTTCTCCACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-1757s1c1
Sequence:CCGGGAAGCACTTTAAGGACGAGGACTCGAGTCCTCGTCCTTAAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015898.2-2561s1c1
Sequence:CCGGGCCACTGAGACACAAACCTATCTCGAGATAGGTTTGTGTCTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-1751s1c1
Sequence:CCGGCCAGGAGAAGCACTTTAAGGACTCGAGTCCTTAAAGTGCTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015898
ZBTB7A MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 7A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-319s1c1
Sequence:CCGGGCCAGTACTTCAAGAAGCTGTCTCGAGACAGCTTCTTGAAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-320s1c1
Sequence:CCGGCCAGTACTTCAAGAAGCTGTTCTCGAGAACAGCTTCTTGAAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015898.2-3928s1c1
Sequence:CCGGCCGTTTGCATATGCAATGCTACTCGAGTAGCATTGCATATGCAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015898.2-2562s1c1
Sequence:CCGGCCACTGAGACACAAACCTATTCTCGAGAATAGGTTTGTGTCTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-578s1c1
Sequence:CCGGGCTGGACCTTGTAGATCAAATCTCGAGATTTGATCTACAAGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-793s1c1
Sequence:CCGGGCAACGGCTTAGACTTCTATGCTCGAGCATAGAAGTCTAAGCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-368s1c1
Sequence:CCGGGAACGTGTACGAGATCGACTTCTCGAGAAGTCGATCTCGTACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-1259s1c1
Sequence:CCGGGCAGAAGGTGGAGAAGAAGATCTCGAGATCTTCTTCTCCACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-1757s1c1
Sequence:CCGGGAAGCACTTTAAGGACGAGGACTCGAGTCCTCGTCCTTAAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015898.2-2561s1c1
Sequence:CCGGGCCACTGAGACACAAACCTATCTCGAGATAGGTTTGTGTCTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-1751s1c1
Sequence:CCGGCCAGGAGAAGCACTTTAAGGACTCGAGTCCTTAAAGTGCTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015898
ZBTB7A MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 7A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138716    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-319s1c1
Sequence:CCGGGCCAGTACTTCAAGAAGCTGTCTCGAGACAGCTTCTTGAAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136520    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-320s1c1
Sequence:CCGGCCAGTACTTCAAGAAGCTGTTCTCGAGAACAGCTTCTTGAAGTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015898.2-3928s1c1
Sequence:CCGGCCGTTTGCATATGCAATGCTACTCGAGTAGCATTGCATATGCAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136851    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015898.2-2562s1c1
Sequence:CCGGCCACTGAGACACAAACCTATTCTCGAGAATAGGTTTGTGTCTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137332    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-578s1c1
Sequence:CCGGGCTGGACCTTGTAGATCAAATCTCGAGATTTGATCTACAAGGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-793s1c1
Sequence:CCGGGCAACGGCTTAGACTTCTATGCTCGAGCATAGAAGTCTAAGCCGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-368s1c1
Sequence:CCGGGAACGTGTACGAGATCGACTTCTCGAGAAGTCGATCTCGTACACGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-1259s1c1
Sequence:CCGGGCAGAAGGTGGAGAAGAAGATCTCGAGATCTTCTTCTCCACCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015898.2-1757s1c1
Sequence:CCGGGAAGCACTTTAAGGACGAGGACTCGAGTCCTCGTCCTTAAAGTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138671    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015898.2-2561s1c1
Sequence:CCGGGCCACTGAGACACAAACCTATCTCGAGATAGGTTTGTGTCTCAGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138519    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015898.2-1751s1c1
Sequence:CCGGCCAGGAGAAGCACTTTAAGGACTCGAGTCCTTAAAGTGCTTCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010731
VALIDATED
ZBTB7A MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 7A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-538s1c1
Sequence:CCGGCTTTGCGACGTGGTGATTCTTCTCGAGAAGAATCACCACGTCGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-1737s1c1
Sequence:CCGGCCAGTGCGATAGCTGCTGCAACTCGAGTTGCAGCAGCTATCGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010731.2-826s1c1
Sequence:CCGGCGTCAGATTCTGGCGGCTGATCTCGAGATCAGCCGCCAGAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010731.2-3786s1c1
Sequence:CCGGCCGCTGACAAATGTCTTTCTTCTCGAGAAGAAAGACATTTGTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-1059s1c1
Sequence:CCGGCGACTGCAATGGCTTGGACTTCTCGAGAAGTCCAAGCCATTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1577s21c1
Sequence:CCGGCCATCTGCGAGAAGGTGATTCCTCGAGGAATCACCTTCTCGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1472s21c1
Sequence:CCGGACTACTACCTGAAGTACTTCACTCGAGTGAAGTACTTCAGGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010731.3-2274s21c1
Sequence:CCGGCGGACGTGTGTGCGTGTATATCTCGAGATATACACGCACACACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1651s21c1
Sequence:CCGGTACGAGTGTAACATCTGTAAACTCGAGTTTACAGATGTTACACTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010731.3-2141s21c1
Sequence:CCGGTCGCAACCTGACTCGTATTAACTCGAGTTAATACGAGTCAGGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010731
VALIDATED
ZBTB7A MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 7A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-538s1c1
Sequence:CCGGCTTTGCGACGTGGTGATTCTTCTCGAGAAGAATCACCACGTCGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-1737s1c1
Sequence:CCGGCCAGTGCGATAGCTGCTGCAACTCGAGTTGCAGCAGCTATCGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010731.2-826s1c1
Sequence:CCGGCGTCAGATTCTGGCGGCTGATCTCGAGATCAGCCGCCAGAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010731.2-3786s1c1
Sequence:CCGGCCGCTGACAAATGTCTTTCTTCTCGAGAAGAAAGACATTTGTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-1059s1c1
Sequence:CCGGCGACTGCAATGGCTTGGACTTCTCGAGAAGTCCAAGCCATTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1577s21c1
Sequence:CCGGCCATCTGCGAGAAGGTGATTCCTCGAGGAATCACCTTCTCGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1472s21c1
Sequence:CCGGACTACTACCTGAAGTACTTCACTCGAGTGAAGTACTTCAGGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010731.3-2274s21c1
Sequence:CCGGCGGACGTGTGTGCGTGTATATCTCGAGATATACACGCACACACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1651s21c1
Sequence:CCGGTACGAGTGTAACATCTGTAAACTCGAGTTTACAGATGTTACACTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010731.3-2141s21c1
Sequence:CCGGTCGCAACCTGACTCGTATTAACTCGAGTTAATACGAGTCAGGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010731
VALIDATED
ZBTB7A MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 7A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-538s1c1
Sequence:CCGGCTTTGCGACGTGGTGATTCTTCTCGAGAAGAATCACCACGTCGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-1737s1c1
Sequence:CCGGCCAGTGCGATAGCTGCTGCAACTCGAGTTGCAGCAGCTATCGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010731.2-826s1c1
Sequence:CCGGCGTCAGATTCTGGCGGCTGATCTCGAGATCAGCCGCCAGAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124244    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010731.2-3786s1c1
Sequence:CCGGCCGCTGACAAATGTCTTTCTTCTCGAGAAGAAAGACATTTGTCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010731.2-1059s1c1
Sequence:CCGGCGACTGCAATGGCTTGGACTTCTCGAGAAGTCCAAGCCATTGCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1577s21c1
Sequence:CCGGCCATCTGCGAGAAGGTGATTCCTCGAGGAATCACCTTCTCGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1472s21c1
Sequence:CCGGACTACTACCTGAAGTACTTCACTCGAGTGAAGTACTTCAGGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010731.3-2274s21c1
Sequence:CCGGCGGACGTGTGTGCGTGTATATCTCGAGATATACACGCACACACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010731.3-1651s21c1
Sequence:CCGGTACGAGTGTAACATCTGTAAACTCGAGTTTACAGATGTTACACTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010731.3-2141s21c1
Sequence:CCGGTCGCAACCTGACTCGTATTAACTCGAGTTAATACGAGTCAGGTTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks