EMAIL THIS PAGE TO A FRIEND

ZBTB7B

zinc finger and BTB domain containing 7B

Synonyms: THPOK ZBTB15 ZFP-67 ZFP67 ZNF857B c-KROX hcKROX
UniProtKB ID: O15156, B4E3K5, D3DV83, J3KQQ3, Q68DR2, Q96EP2
Gene ID:
Human(51043) Summary: This gene encodes a zinc finger-containing transcription factor that acts as a key regulator of lineage commitment of immature T-cell precursors. It is necessary and sufficient for commitment of CD4 lineage, while its absence causes CD8 commitment. It also functions as a transcriptional repressor of type I collagen genes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(22724) zinc finger and BTB domain containing 7B
Rat(295248) zinc finger and BTB domain containing 7B
domestic guinea pig(100735855) zinc finger and BTB domain containing 7B
naked mole-rat(101714994) zinc finger and BTB domain containing 7B
cow(509019) zinc finger and BTB domain containing 7B
sheep(101114915) zinc finger and BTB domain containing 7B
Horse(100057144) zinc finger and BTB domain containing 7B
domestic cat(101096033) zinc finger and BTB domain containing 7B
dog(490437) zinc finger and BTB domain containing 7B
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015872 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015872 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015872 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009565 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009565 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009565 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU071621 MISSION® esiRNA esiRNA human ZBTB7B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015872 Rosetta Predictions human pricing
NM_001106446 Rosetta Predictions rat pricing
NM_009565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015872 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087310 predicted 1087
2 SASI_Hs02_00348455 predicted 1997
3 SASI_Hs01_00087311 predicted 1221
4 SASI_Hs01_00087312 predicted 447
5 SASI_Hs01_00087313 predicted 1287
6 SASI_Hs01_00087314 predicted 761
7 SASI_Hs02_00348456 predicted 426
8 SASI_Hs01_00087315 predicted 1295
9 SASI_Hs01_00087317 predicted 1757
10 SASI_Hs01_00087318 predicted 559
11 SASI_Hs01_00087316 predicted 376
12 SASI_Hs01_00087319 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219038 predicted 904
2 SASI_Rn02_00219039 predicted 654
3 SASI_Rn02_00219040 predicted 895
4 SASI_Rn02_00219041 predicted 953
5 SASI_Rn02_00219042 predicted 840
6 SASI_Rn02_00219043 predicted 610
7 SASI_Rn02_00219044 predicted 268
8 SASI_Rn02_00219045 predicted 1062
9 SASI_Rn02_00219046 predicted 838
10 SASI_Rn02_00219047 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316432 predicted 1330
2 SASI_Mm01_00038792 predicted 1252
3 SASI_Mm01_00038794 predicted 431
4 SASI_Mm01_00038795 predicted 1482
5 SASI_Mm01_00038796 predicted 503
6 SASI_Mm01_00038798 predicted 515
7 SASI_Mm01_00038799 predicted 523
8 SASI_Mm01_00038800 predicted 900
9 SASI_Mm01_00038801 predicted 695
10 SASI_Mm02_00316433 predicted 1261
11 SASI_Mm01_00038793 predicted 1085
12 SASI_Mm01_00038797 predicted 339
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015872
VALIDATED
ZBTB7B MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 7B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-959s21c1
Sequence:CCGGCCAGAGCTACGAACCCTATGACTCGAGTCATAGGGTTCGTAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-770s21c1
Sequence:CCGGCCGGAAAGCTTTCCTGCAAACCTCGAGGTTTGCAGGAAAGCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-559s21c1
Sequence:CCGGTCGCTGCTTGCATGGAGATTCCTCGAGGAATCTCCATGCAAGCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-418s21c1
Sequence:CCGGGTGTGTGTGAGCTGGACTTTGCTCGAGCAAAGTCCAGCTCACACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015872.2-2060s21c1
Sequence:CCGGGAGTAGAAGCAATAATGTATTCTCGAGAATACATTATTGCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015872.1-514s1c1
Sequence:CCGGCCCTCCTTGAATTTGCCTATACTCGAGTATAGGCAAATTCAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015872.1-690s1c1
Sequence:CCGGCGCCAGTATCTGGAGGCCTTTCTCGAGAAAGGCCTCCAGATACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1694s1c1
Sequence:CCGGCCGCCTCTCTCTAGCTCGATTCTCGAGAATCGAGCTAGAGAGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1044s1c1
Sequence:CCGGGAAGAAGAGGAGCTGGTATATCTCGAGATATACCAGCTCCTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1146s1c1
Sequence:CCGGCCTGACCTGATGGCCTACCTACTCGAGTAGGTAGGCCATCAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015872
VALIDATED
ZBTB7B MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 7B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-959s21c1
Sequence:CCGGCCAGAGCTACGAACCCTATGACTCGAGTCATAGGGTTCGTAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-770s21c1
Sequence:CCGGCCGGAAAGCTTTCCTGCAAACCTCGAGGTTTGCAGGAAAGCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-559s21c1
Sequence:CCGGTCGCTGCTTGCATGGAGATTCCTCGAGGAATCTCCATGCAAGCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-418s21c1
Sequence:CCGGGTGTGTGTGAGCTGGACTTTGCTCGAGCAAAGTCCAGCTCACACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015872.2-2060s21c1
Sequence:CCGGGAGTAGAAGCAATAATGTATTCTCGAGAATACATTATTGCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015872.1-514s1c1
Sequence:CCGGCCCTCCTTGAATTTGCCTATACTCGAGTATAGGCAAATTCAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015872.1-690s1c1
Sequence:CCGGCGCCAGTATCTGGAGGCCTTTCTCGAGAAAGGCCTCCAGATACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1694s1c1
Sequence:CCGGCCGCCTCTCTCTAGCTCGATTCTCGAGAATCGAGCTAGAGAGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1044s1c1
Sequence:CCGGGAAGAAGAGGAGCTGGTATATCTCGAGATATACCAGCTCCTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1146s1c1
Sequence:CCGGCCTGACCTGATGGCCTACCTACTCGAGTAGGTAGGCCATCAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015872
VALIDATED
ZBTB7B MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 7B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-959s21c1
Sequence:CCGGCCAGAGCTACGAACCCTATGACTCGAGTCATAGGGTTCGTAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-770s21c1
Sequence:CCGGCCGGAAAGCTTTCCTGCAAACCTCGAGGTTTGCAGGAAAGCTTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-559s21c1
Sequence:CCGGTCGCTGCTTGCATGGAGATTCCTCGAGGAATCTCCATGCAAGCAGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015872.2-418s21c1
Sequence:CCGGGTGTGTGTGAGCTGGACTTTGCTCGAGCAAAGTCCAGCTCACACACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015872.2-2060s21c1
Sequence:CCGGGAGTAGAAGCAATAATGTATTCTCGAGAATACATTATTGCTTCTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015872.1-514s1c1
Sequence:CCGGCCCTCCTTGAATTTGCCTATACTCGAGTATAGGCAAATTCAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015872.1-690s1c1
Sequence:CCGGCGCCAGTATCTGGAGGCCTTTCTCGAGAAAGGCCTCCAGATACTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1694s1c1
Sequence:CCGGCCGCCTCTCTCTAGCTCGATTCTCGAGAATCGAGCTAGAGAGAGGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1044s1c1
Sequence:CCGGGAAGAAGAGGAGCTGGTATATCTCGAGATATACCAGCTCCTCTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_015872.1-1146s1c1
Sequence:CCGGCCTGACCTGATGGCCTACCTACTCGAGTAGGTAGGCCATCAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009565
ZBTB7B MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 7B
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000240696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3402s21c1
Sequence:CCGGGGACCAGTCCCTGTATCTATTCTCGAGAATAGATACAGGGACTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3123s21c1
Sequence:CCGGGTCTTGTTGAAATCCAATTTCCTCGAGGAAATTGGATTTCAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3325s21c1
Sequence:CCGGATGCACCTCCATGCCCATTTGCTCGAGCAAATGGGCATGGAGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-2183s21c1
Sequence:CCGGGCAATAATCTATCTCTGATTTCTCGAGAAATCAGAGATAGATTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3466s21c1
Sequence:CCGGCTGGGCCTCATCTTAGCATTTCTCGAGAAATGCTAAGATGAGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009565.3-778s1c1
Sequence:CCGGGAGATAGCTATAGTCCTCCTACTCGAGTAGGAGGACTATAGCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009565.3-828s1c1
Sequence:CCGGCTGAACTATGAAGTCTTTGAACTCGAGTTCAAAGACTTCATAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009565
ZBTB7B MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 7B
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000240696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3402s21c1
Sequence:CCGGGGACCAGTCCCTGTATCTATTCTCGAGAATAGATACAGGGACTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3123s21c1
Sequence:CCGGGTCTTGTTGAAATCCAATTTCCTCGAGGAAATTGGATTTCAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3325s21c1
Sequence:CCGGATGCACCTCCATGCCCATTTGCTCGAGCAAATGGGCATGGAGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-2183s21c1
Sequence:CCGGGCAATAATCTATCTCTGATTTCTCGAGAAATCAGAGATAGATTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3466s21c1
Sequence:CCGGCTGGGCCTCATCTTAGCATTTCTCGAGAAATGCTAAGATGAGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009565.3-778s1c1
Sequence:CCGGGAGATAGCTATAGTCCTCCTACTCGAGTAGGAGGACTATAGCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009565.3-828s1c1
Sequence:CCGGCTGAACTATGAAGTCTTTGAACTCGAGTTCAAAGACTTCATAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009565
ZBTB7B MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 7B
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000240696    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3402s21c1
Sequence:CCGGGGACCAGTCCCTGTATCTATTCTCGAGAATAGATACAGGGACTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3123s21c1
Sequence:CCGGGTCTTGTTGAAATCCAATTTCCTCGAGGAAATTGGATTTCAACAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3325s21c1
Sequence:CCGGATGCACCTCCATGCCCATTTGCTCGAGCAAATGGGCATGGAGGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240693    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-2183s21c1
Sequence:CCGGGCAATAATCTATCTCTGATTTCTCGAGAAATCAGAGATAGATTATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009565.4-3466s21c1
Sequence:CCGGCTGGGCCTCATCTTAGCATTTCTCGAGAAATGCTAAGATGAGGCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009565.3-778s1c1
Sequence:CCGGGAGATAGCTATAGTCCTCCTACTCGAGTAGGAGGACTATAGCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009565.3-828s1c1
Sequence:CCGGCTGAACTATGAAGTCTTTGAACTCGAGTTCAAAGACTTCATAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks