EMAIL THIS PAGE TO A FRIEND

ZBTB7C

zinc finger and BTB domain containing 7C

Synonyms: APM-1 APM1 ZBTB36 ZNF857C
UniProtKB ID: A1YPR0, O73453
Gene ID:
Mouse(207259) zinc finger and BTB domain containing 7C
Rat(679155) zinc finger and BTB domain containing 7C
chicken(431576) zinc finger and BTB domain containing 7C
dog(490573) zinc finger and BTB domain containing 7C
Horse(100053521) zinc finger and BTB domain containing 7C
domestic cat(101087616) zinc finger and BTB domain containing 7C
cow(614110) zinc finger and BTB domain containing 7C
sheep(101114660) zinc finger and BTB domain containing 7C
Goat(100861017) zinc finger and BTB domain containing 7C
naked mole-rat(101715960) zinc finger and BTB domain containing 7C
domestic guinea pig(100726674) zinc finger and BTB domain containing 7C
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA014433 Anti-ZBTB7C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
AV32872 Anti-ZBTB7C antibody produced in rabbit IgG fraction of antiserum rat, mouse, guinea pig, bovine, human, horse, rabbit, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145356 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145356 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145356 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001039360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039360 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031251 MISSION® esiRNA esiRNA targeting mouse Zbtb7c (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039360 Rosetta Predictions human pricing
NM_001127375 Rosetta Predictions rat pricing
NM_145356 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133700 predicted 739
2 SASI_Hs01_00133701 predicted 994
3 SASI_Hs01_00133702 predicted 764
4 SASI_Hs02_00308467 predicted 853
5 SASI_Hs02_00308468 predicted 2107
6 SASI_Hs01_00133703 predicted 914
7 SASI_Hs01_00133704 predicted 1007
8 SASI_Hs01_00133706 predicted 997
9 SASI_Hs01_00133707 predicted 2055
10 SASI_Hs01_00133708 predicted 1193
11 SASI_Hs01_00133705 predicted 2294
12 SASI_Hs01_00133709 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253693 predicted 1440
2 SASI_Rn02_00253694 predicted 2765
3 SASI_Rn02_00253695 predicted 1940
4 SASI_Rn02_00253696 predicted 1359
5 SASI_Rn02_00253697 predicted 2746
6 SASI_Rn02_00253698 predicted 1171
7 SASI_Rn02_00253699 predicted 1360
8 SASI_Rn02_00253700 predicted 1702
9 SASI_Rn02_00253701 predicted 1441
10 SASI_Rn02_00253702 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145356 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187959 predicted 1472
2 SASI_Mm01_00187960 predicted 1312
3 SASI_Mm01_00187961 predicted 1302
4 SASI_Mm02_00340617 predicted 491
5 SASI_Mm01_00187962 predicted 1752
6 SASI_Mm02_00340618 predicted 1642
7 SASI_Mm01_00187965 predicted 1735
8 SASI_Mm01_00187966 predicted 1824
9 SASI_Mm02_00340619 predicted 2697
10 SASI_Mm01_00187967 predicted 1236
11 SASI_Mm01_00187963 predicted 1402
12 SASI_Mm01_00187964 predicted 1400
13 SASI_Mm01_00187968 predicted 1474
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145356
ZBTB7C MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 7C
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000124444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145356.3-3659s1c1
Sequence:CCGGCCACGCTTTCTTGAATTTGTACTCGAGTACAAATTCAAGAAAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-1205s1c1
Sequence:CCGGCTGACAGAAGACCCTCCTTATCTCGAGATAAGGAGGGTCTTCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-1581s1c1
Sequence:CCGGCATCTGCCACAAGGTCATCATCTCGAGATGATGACCTTGTGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-695s1c1
Sequence:CCGGCCTACGTGTATGAGATCGACTCTCGAGAGTCGATCTCATACACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145356
ZBTB7C MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 7C
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000124444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145356.3-3659s1c1
Sequence:CCGGCCACGCTTTCTTGAATTTGTACTCGAGTACAAATTCAAGAAAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-1205s1c1
Sequence:CCGGCTGACAGAAGACCCTCCTTATCTCGAGATAAGGAGGGTCTTCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-1581s1c1
Sequence:CCGGCATCTGCCACAAGGTCATCATCTCGAGATGATGACCTTGTGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-695s1c1
Sequence:CCGGCCTACGTGTATGAGATCGACTCTCGAGAGTCGATCTCATACACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145356
ZBTB7C MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 7C
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000124444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145356.3-3659s1c1
Sequence:CCGGCCACGCTTTCTTGAATTTGTACTCGAGTACAAATTCAAGAAAGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-1205s1c1
Sequence:CCGGCTGACAGAAGACCCTCCTTATCTCGAGATAAGGAGGGTCTTCTGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-1581s1c1
Sequence:CCGGCATCTGCCACAAGGTCATCATCTCGAGATGATGACCTTGTGGCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145356.3-695s1c1
Sequence:CCGGCCTACGTGTATGAGATCGACTCTCGAGAGTCGATCTCATACACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039360
ZBTB7C MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 7C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-234s21c1
Sequence:CCGGACGTCTATGAGATCGACTTTGCTCGAGCAAAGTCGATCTCATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-510s21c1
Sequence:CCGGATGATGACACGGAGGACTTTGCTCGAGCAAAGTCCTCCGTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-598s21c1
Sequence:CCGGTCTCACAGAGAAGGCCTATTCCTCGAGGAATAGGCCTTCTCTGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-999s21c1
Sequence:CCGGAGAACGACTACGGTGCCTATCCTCGAGGATAGGCACCGTAGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039360.1-2665s21c1
Sequence:CCGGTATCACATCCAGCTCTATATTCTCGAGAATATAGAGCTGGATGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039360
ZBTB7C MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 7C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-234s21c1
Sequence:CCGGACGTCTATGAGATCGACTTTGCTCGAGCAAAGTCGATCTCATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-510s21c1
Sequence:CCGGATGATGACACGGAGGACTTTGCTCGAGCAAAGTCCTCCGTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-598s21c1
Sequence:CCGGTCTCACAGAGAAGGCCTATTCCTCGAGGAATAGGCCTTCTCTGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-999s21c1
Sequence:CCGGAGAACGACTACGGTGCCTATCCTCGAGGATAGGCACCGTAGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039360.1-2665s21c1
Sequence:CCGGTATCACATCCAGCTCTATATTCTCGAGAATATAGAGCTGGATGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039360
ZBTB7C MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 7C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-234s21c1
Sequence:CCGGACGTCTATGAGATCGACTTTGCTCGAGCAAAGTCGATCTCATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-510s21c1
Sequence:CCGGATGATGACACGGAGGACTTTGCTCGAGCAAAGTCCTCCGTGTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235014    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-598s21c1
Sequence:CCGGTCTCACAGAGAAGGCCTATTCCTCGAGGAATAGGCCTTCTCTGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039360.1-999s21c1
Sequence:CCGGAGAACGACTACGGTGCCTATCCTCGAGGATAGGCACCGTAGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039360.1-2665s21c1
Sequence:CCGGTATCACATCCAGCTCTATATTCTCGAGAATATAGAGCTGGATGTGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks