EMAIL THIS PAGE TO A FRIEND

ZBTB8A

zinc finger and BTB domain containing 8A

Synonyms: BOZF1 ZBTB8 ZNF916A
UniProtKB ID: Q96BR9, Q8IUL5, Q8IWR9, Q8N2Y5, Q96BX0
Gene ID:
Mouse(73680) zinc finger and BTB domain containing 8a
Rat(313049) zinc finger and BTB domain containing 8a
domestic guinea pig(100726759) zinc finger and BTB domain containing 8A
naked mole-rat(101719961) zinc finger and BTB domain containing 8A
Domestic Rabbit(100353816) zinc finger and BTB domain containing 8A
cow(541221) zinc finger and BTB domain containing 8A
sheep(101112885) zinc finger and BTB domain containing 8A
chicken(419661) zinc finger and BTB domain containing 8A
domestic cat(101100743) zinc finger and BTB domain containing 8A
dog(487304) zinc finger and BTB domain containing 8A
Horse(100055796) zinc finger and BTB domain containing 8A
151 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028603 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028603 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028603 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040441 Rosetta Predictions human pricing
NM_001107913 Rosetta Predictions rat pricing
NM_028603 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229155 predicted 983
2 SASI_Hs02_00308976 predicted 1784
3 SASI_Hs01_00229156 predicted 1172
4 SASI_Hs02_00308977 predicted 707
5 SASI_Hs01_00229157 predicted 1403
6 SASI_Hs02_00308978 predicted 1733
7 SASI_Hs02_00308979 predicted 1139
8 SASI_Hs01_00229160 predicted 1668
9 SASI_Hs01_00229161 predicted 747
10 SASI_Hs01_00229162 predicted 1696
11 SASI_Hs01_00229158 predicted 902
12 SASI_Hs01_00229159 predicted 1091
13 SASI_Hs01_00229163 predicted 1442
14 SASI_Hs01_00229164 predicted 1805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233515 predicted 714
2 SASI_Rn02_00233516 predicted 1007
3 SASI_Rn02_00233517 predicted 1542
4 SASI_Rn02_00233518 predicted 1726
5 SASI_Rn02_00233519 predicted 1036
6 SASI_Rn02_00233520 predicted 584
7 SASI_Rn02_00233521 predicted 1642
8 SASI_Rn02_00233522 predicted 857
9 SASI_Rn02_00233523 predicted 1191
10 SASI_Rn02_00233524 predicted 1747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028603 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334087 predicted 769
2 SASI_Mm02_00334088 predicted 1326
3 SASI_Mm02_00334089 predicted 1575
4 SASI_Mm02_00334090 predicted 1220
5 SASI_Mm02_00334091 predicted 657
6 SASI_Mm02_00334092 predicted 708
7 SASI_Mm02_00334093 predicted 1668
8 SASI_Mm02_00334094 predicted 633
9 SASI_Mm02_00334095 predicted 968
10 SASI_Mm02_00334096 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028603
VALIDATED
ZBTB8A MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 8A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028603.4-1889s21c1
Sequence:CCGGTGGCATGACAGATGATCAATTCTCGAGAATTGATCATCTGTCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-512s21c1
Sequence:CCGGTTGCAAGCAGCGGCTACTTTACTCGAGTAAAGTAGCCGCTGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-1339s21c1
Sequence:CCGGAGTAGCCATTTCCGAACTATTCTCGAGAATAGTTCGGAAATGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-615s21c1
Sequence:CCGGAGTCATCCTGGACTTCGTATACTCGAGTATACGAAGTCCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-1017s21c1
Sequence:CCGGACCGTCTGAAGTCGTTCATTTCTCGAGAAATGAACGACTTCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028603.1-1718s1c1
Sequence:CCGGGCCTGCAATTTACACAGACATCTCGAGATGTCTGTGTAAATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028603.1-492s1c1
Sequence:CCGGGCGCATCGGAATGTCTTGTTTCTCGAGAAACAAGACATTCCGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028603.1-645s1c1
Sequence:CCGGCTCTCTCTTACGGGACAGAATCTCGAGATTCTGTCCCGTAAGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028603.1-1568s1c1
Sequence:CCGGCGAGGAAGAGAATAGATCCTACTCGAGTAGGATCTATTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028603.1-1199s1c1
Sequence:CCGGGCTTCGGTTCAAATGCCCATTCTCGAGAATGGGCATTTGAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028603
VALIDATED
ZBTB8A MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 8A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028603.4-1889s21c1
Sequence:CCGGTGGCATGACAGATGATCAATTCTCGAGAATTGATCATCTGTCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-512s21c1
Sequence:CCGGTTGCAAGCAGCGGCTACTTTACTCGAGTAAAGTAGCCGCTGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-1339s21c1
Sequence:CCGGAGTAGCCATTTCCGAACTATTCTCGAGAATAGTTCGGAAATGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-615s21c1
Sequence:CCGGAGTCATCCTGGACTTCGTATACTCGAGTATACGAAGTCCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-1017s21c1
Sequence:CCGGACCGTCTGAAGTCGTTCATTTCTCGAGAAATGAACGACTTCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028603.1-1718s1c1
Sequence:CCGGGCCTGCAATTTACACAGACATCTCGAGATGTCTGTGTAAATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028603.1-492s1c1
Sequence:CCGGGCGCATCGGAATGTCTTGTTTCTCGAGAAACAAGACATTCCGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028603.1-645s1c1
Sequence:CCGGCTCTCTCTTACGGGACAGAATCTCGAGATTCTGTCCCGTAAGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028603.1-1568s1c1
Sequence:CCGGCGAGGAAGAGAATAGATCCTACTCGAGTAGGATCTATTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028603.1-1199s1c1
Sequence:CCGGGCTTCGGTTCAAATGCCCATTCTCGAGAATGGGCATTTGAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028603
VALIDATED
ZBTB8A MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 8A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350637    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028603.4-1889s21c1
Sequence:CCGGTGGCATGACAGATGATCAATTCTCGAGAATTGATCATCTGTCATGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-512s21c1
Sequence:CCGGTTGCAAGCAGCGGCTACTTTACTCGAGTAAAGTAGCCGCTGCTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-1339s21c1
Sequence:CCGGAGTAGCCATTTCCGAACTATTCTCGAGAATAGTTCGGAAATGGCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-615s21c1
Sequence:CCGGAGTCATCCTGGACTTCGTATACTCGAGTATACGAAGTCCAGGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028603.4-1017s21c1
Sequence:CCGGACCGTCTGAAGTCGTTCATTTCTCGAGAAATGAACGACTTCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084788    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028603.1-1718s1c1
Sequence:CCGGGCCTGCAATTTACACAGACATCTCGAGATGTCTGTGTAAATTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028603.1-492s1c1
Sequence:CCGGGCGCATCGGAATGTCTTGTTTCTCGAGAAACAAGACATTCCGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_028603.1-645s1c1
Sequence:CCGGCTCTCTCTTACGGGACAGAATCTCGAGATTCTGTCCCGTAAGAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028603.1-1568s1c1
Sequence:CCGGCGAGGAAGAGAATAGATCCTACTCGAGTAGGATCTATTCTCTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028603.1-1199s1c1
Sequence:CCGGGCTTCGGTTCAAATGCCCATTCTCGAGAATGGGCATTTGAACCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks