EMAIL THIS PAGE TO A FRIEND

ZBTB8B

zinc finger and BTB domain containing 8B

Synonyms: RP1-27O5.1 ZNF916B
UniProtKB ID: Q8NAP8, Q15DG5, Q5VXR5, Q69YT7
Gene ID:
Mouse(215627) zinc finger and BTB domain containing 8b
Rat(500553) zinc finger and BTB domain containing 8b
Zebrafish(550243) zinc finger and BTB domain containing 8B
dog(487306) zinc finger and BTB domain containing 8B
domestic cat(101100496) zinc finger and BTB domain containing 8B
Horse(100630269) zinc finger and BTB domain containing 8B
chicken(419659) zinc finger and BTB domain containing 8B
cow(521943) zinc finger and BTB domain containing 8B
sheep(101113392) zinc finger and BTB domain containing 8B
naked mole-rat(101718914) zinc finger and BTB domain containing 8B
domestic guinea pig(100728711) zinc finger and BTB domain containing 8B
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001145720 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145720 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145720 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU027751 MISSION® esiRNA esiRNA targeting mouse Zbtb8b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XR_040711 Rosetta Predictions human pricing
XR_040712 Rosetta Predictions human pricing
XR_040713 Rosetta Predictions human pricing
NM_001109265 Rosetta Predictions rat pricing
NM_153541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521237 predicted 1784
2 SASI_Hs02_00521238 predicted 1237
3 SASI_Hs02_00521239 predicted 2515
4 SASI_Hs02_00521240 predicted 1879
5 SASI_Hs02_00521241 predicted 2372
6 SASI_Hs02_00521242 predicted 232
7 SASI_Hs02_00521243 predicted 3477
8 SASI_Hs02_00521244 predicted 1740
9 SASI_Hs02_00521245 predicted 1606
10 SASI_Hs02_00521246 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521247 predicted 2358
2 SASI_Hs02_00521248 predicted 1764
3 SASI_Hs02_00521249 predicted 1216
4 SASI_Hs02_00521250 predicted 2493
5 SASI_Hs02_00521251 predicted 1858
6 SASI_Hs02_00521252 predicted 2354
7 SASI_Hs02_00521253 predicted 3456
8 SASI_Hs02_00521254 predicted 1719
9 SASI_Hs02_00521255 predicted 1581
10 SASI_Hs02_00521256 predicted 1435
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00521257 predicted 1787
2 SASI_Hs02_00521258 predicted 1228
3 SASI_Hs02_00521259 predicted 2518
4 SASI_Hs02_00521260 predicted 1879
5 SASI_Hs02_00521261 predicted 2377
6 SASI_Hs02_00521262 predicted 225
7 SASI_Hs02_00521263 predicted 3474
8 SASI_Hs02_00521264 predicted 1734
9 SASI_Hs02_00521265 predicted 1600
10 SASI_Hs02_00521266 predicted 1454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109265 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246714 predicted 793
2 SASI_Rn02_00246715 predicted 1506
3 SASI_Rn02_00246716 predicted 1527
4 SASI_Rn02_00246717 predicted 686
5 SASI_Rn02_00246718 predicted 1470
6 SASI_Rn02_00246719 predicted 1442
7 SASI_Rn02_00246720 predicted 1544
8 SASI_Rn02_00246721 predicted 705
9 SASI_Rn02_00246722 predicted 1511
10 SASI_Rn02_00246723 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099818 predicted 1243
2 SASI_Mm01_00099819 predicted 1421
3 SASI_Mm01_00099820 predicted 622
4 SASI_Mm01_00099821 predicted 310
5 SASI_Mm01_00099822 predicted 630
6 SASI_Mm01_00099823 predicted 537
7 SASI_Mm01_00099824 predicted 409
8 SASI_Mm01_00099825 predicted 935
9 SASI_Mm02_00343307 predicted 200
10 SASI_Mm01_00099827 predicted 538
11 SASI_Mm01_00099826 predicted 922
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153541
ZBTB8B MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 8B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153541.1-2068s1c1
Sequence:CCGGGCAGACAAACACTGACACAAACTCGAGTTTGTGTCAGTGTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-921s1c1
Sequence:CCGGCAGAGCAAAGATGACTTGGATCTCGAGATCCAAGTCATCTTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-622s1c1
Sequence:CCGGGTCTAGACTGTACAATATCATCTCGAGATGATATTGTACAGTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-356s1c1
Sequence:CCGGCGAGAATGTGATCGAAGTCATCTCGAGATGACTTCGATCACATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153541.3-123s21c1
Sequence:CCGGAGTTGAATGAGCAGCGGAAACCTCGAGGTTTCCGCTGCTCATTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153541.3-788s21c1
Sequence:CCGGGACGAACAGCTACAGCAATATCTCGAGATATTGCTGTAGCTGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153541.3-1748s21c1
Sequence:CCGGGTACTGACTGAATTGAGATTGCTCGAGCAATCTCAATTCAGTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153541.3-1860s21c1
Sequence:CCGGTTTACGTTCTTACATCATTACCTCGAGGTAATGATGTAAGAACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153541
ZBTB8B MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 8B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153541.1-2068s1c1
Sequence:CCGGGCAGACAAACACTGACACAAACTCGAGTTTGTGTCAGTGTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-921s1c1
Sequence:CCGGCAGAGCAAAGATGACTTGGATCTCGAGATCCAAGTCATCTTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-622s1c1
Sequence:CCGGGTCTAGACTGTACAATATCATCTCGAGATGATATTGTACAGTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-356s1c1
Sequence:CCGGCGAGAATGTGATCGAAGTCATCTCGAGATGACTTCGATCACATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153541.3-123s21c1
Sequence:CCGGAGTTGAATGAGCAGCGGAAACCTCGAGGTTTCCGCTGCTCATTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153541.3-788s21c1
Sequence:CCGGGACGAACAGCTACAGCAATATCTCGAGATATTGCTGTAGCTGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153541.3-1748s21c1
Sequence:CCGGGTACTGACTGAATTGAGATTGCTCGAGCAATCTCAATTCAGTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153541.3-1860s21c1
Sequence:CCGGTTTACGTTCTTACATCATTACCTCGAGGTAATGATGTAAGAACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153541
ZBTB8B MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 8B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194543    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153541.1-2068s1c1
Sequence:CCGGGCAGACAAACACTGACACAAACTCGAGTTTGTGTCAGTGTTTGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-921s1c1
Sequence:CCGGCAGAGCAAAGATGACTTGGATCTCGAGATCCAAGTCATCTTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-622s1c1
Sequence:CCGGGTCTAGACTGTACAATATCATCTCGAGATGATATTGTACAGTCTAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153541.1-356s1c1
Sequence:CCGGCGAGAATGTGATCGAAGTCATCTCGAGATGACTTCGATCACATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441109    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153541.3-123s21c1
Sequence:CCGGAGTTGAATGAGCAGCGGAAACCTCGAGGTTTCCGCTGCTCATTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153541.3-788s21c1
Sequence:CCGGGACGAACAGCTACAGCAATATCTCGAGATATTGCTGTAGCTGTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153541.3-1748s21c1
Sequence:CCGGGTACTGACTGAATTGAGATTGCTCGAGCAATCTCAATTCAGTCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422135    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153541.3-1860s21c1
Sequence:CCGGTTTACGTTCTTACATCATTACCTCGAGGTAATGATGTAAGAACGTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145720
VALIDATED
ZBTB8B MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 8B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145720.1-1380s21c1
Sequence:CCGGACCCGATGATGATGATGATTTCTCGAGAAATCATCATCATCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145720.1-1564s21c1
Sequence:CCGGGAGACACTTACGTAGCAATAACTCGAGTTATTGCTACGTAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145720.1-240s21c1
Sequence:CCGGAGCCCTGCTCATTCACTATATCTCGAGATATAGTGAATGAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145720.1-443s21c1
Sequence:CCGGTTAGGTCATCCCTCGACATTTCTCGAGAAATGTCGAGGGATGACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145720.1-1630s21c1
Sequence:CCGGGTTGTTGAAAGATACCATTTGCTCGAGCAAATGGTATCTTTCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145720
VALIDATED
ZBTB8B MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 8B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145720.1-1380s21c1
Sequence:CCGGACCCGATGATGATGATGATTTCTCGAGAAATCATCATCATCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145720.1-1564s21c1
Sequence:CCGGGAGACACTTACGTAGCAATAACTCGAGTTATTGCTACGTAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145720.1-240s21c1
Sequence:CCGGAGCCCTGCTCATTCACTATATCTCGAGATATAGTGAATGAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145720.1-443s21c1
Sequence:CCGGTTAGGTCATCCCTCGACATTTCTCGAGAAATGTCGAGGGATGACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145720.1-1630s21c1
Sequence:CCGGGTTGTTGAAAGATACCATTTGCTCGAGCAAATGGTATCTTTCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145720
VALIDATED
ZBTB8B MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 8B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145720.1-1380s21c1
Sequence:CCGGACCCGATGATGATGATGATTTCTCGAGAAATCATCATCATCATCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145720.1-1564s21c1
Sequence:CCGGGAGACACTTACGTAGCAATAACTCGAGTTATTGCTACGTAAGTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001145720.1-240s21c1
Sequence:CCGGAGCCCTGCTCATTCACTATATCTCGAGATATAGTGAATGAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145720.1-443s21c1
Sequence:CCGGTTAGGTCATCCCTCGACATTTCTCGAGAAATGTCGAGGGATGACCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337315    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145720.1-1630s21c1
Sequence:CCGGGTTGTTGAAAGATACCATTTGCTCGAGCAAATGGTATCTTTCAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks