EMAIL THIS PAGE TO A FRIEND

ZBTB8OS

zinc finger and BTB domain containing 8 opposite strand

Synonyms: ARCH ARCH2
UniProtKB ID: Q8IWT0, Q5TGK5, Q6PDA1, Q8IWS9, Q8NEV6, Q8NEV7
Gene ID:
Mouse(67106) zinc finger and BTB domain containing 8 opposite strand
Rat(297885) zinc finger and BTB domain containing 8 opposite strand
domestic guinea pig(100727954) zinc finger and BTB domain containing 8 opposite strand
naked mole-rat(101719250) zinc finger and BTB domain containing 8 opposite strand
cow(613795) zinc finger and BTB domain containing 8 opposite strand
sheep(101112630) zinc finger and BTB domain containing 8 opposite strand
Zebrafish(550382) zinc finger and BTB domain containing 8 opposite strand
chicken(419663) zinc finger and BTB domain containing 8 opposite strand
domestic cat(101100986) zinc finger and BTB domain containing 8 opposite strand
dog(478150) zinc finger and BTB domain containing 8 opposite strand
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178547 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178547 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178547 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178547 Rosetta Predictions human pricing
XM_001060735 Rosetta Predictions rat pricing
XM_216347 Rosetta Predictions rat pricing
NM_025970 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178547 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369781 predicted 391
2 SASI_Hs02_00369782 predicted 388
3 SASI_Hs02_00369783 predicted 388
4 SASI_Hs02_00369784 predicted 402
5 SASI_Hs01_00062426 predicted 298
6 SASI_Hs02_00369785 predicted 392
7 SASI_Hs01_00062427 predicted 297
8 SASI_Hs01_00062428 predicted 380
9 SASI_Hs02_00369786 predicted 408
10 SASI_Hs02_00369787 predicted 385
11 SASI_Hs01_00062429 predicted 40
12 SASI_Hs01_00062430 predicted 524
13 SASI_Hs01_00062431 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060735 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297558 predicted 893
2 SASI_Rn02_00297559 predicted 206
3 SASI_Rn02_00297560 predicted 284
4 SASI_Rn02_00297561 predicted 284
5 SASI_Rn02_00297562 predicted 208
6 SASI_Rn02_00297563 predicted 274
7 SASI_Rn02_00297564 predicted 294
8 SASI_Rn02_00297565 predicted 875
9 SASI_Rn02_00297566 predicted 783
10 SASI_Rn02_00297567 predicted 783
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216347 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00174282 predicted 1166
2 SASI_Rn01_00174283 predicted 320
3 SASI_Rn01_00174284 predicted 557
4 SASI_Rn01_00174285 predicted 555
5 SASI_Rn01_00174286 predicted 380
6 SASI_Rn01_00174287 predicted 319
7 SASI_Rn01_00174288 predicted 368
8 SASI_Rn01_00174289 predicted 485
9 SASI_Rn01_00174290 predicted 549
10 SASI_Rn01_00174291 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00049910 predicted 333
2 SASI_Mm01_00049912 predicted 419
3 SASI_Mm01_00049913 predicted 233
4 SASI_Mm01_00049914 predicted 337
5 SASI_Mm01_00049915 predicted 345
6 SASI_Mm02_00329389 predicted 429
7 SASI_Mm01_00049916 predicted 297
8 SASI_Mm01_00049917 predicted 439
9 SASI_Mm02_00329390 predicted 314
10 SASI_Mm02_00329391 predicted 232
11 SASI_Mm01_00049911 predicted 344
12 SASI_Mm01_00049918 predicted 348
13 SASI_Mm01_00049919 predicted 401
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178547
VALIDATED
ZBTB8OS MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 8 opposite strand
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-194s21c1
Sequence:CCGGGATACTCTGGAGGAAGCATTTCTCGAGAAATGCTTCCTCCAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-120s21c1
Sequence:CCGGCCAAGTATCCGCCAGTCAATACTCGAGTATTGACTGGCGGATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-503s21c1
Sequence:CCGGGCAATGCAGGTCTATAATGAACTCGAGTTCATTATAGACCTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-284s21c1
Sequence:CCGGGAAGTAGAAACCCAAGGAGATCTCGAGATCTCCTTGGGTTTCTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-120s1c1
Sequence:CCGGCCAAGTATCCGCCAGTCAATACTCGAGTATTGACTGGCGGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-305s1c1
Sequence:CCGGGACTTACAGTCTCTTCTGTTTCTCGAGAAACAGAAGAGACTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178547.2-290s1c1
Sequence:CCGGGAAACCCAAGGAGATGACTTACTCGAGTAAGTCATCTCCTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178547.2-503s1c1
Sequence:CCGGGCAATGCAGGTCTATAATGAACTCGAGTTCATTATAGACCTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-284s1c1
Sequence:CCGGGAAGTAGAAACCCAAGGAGATCTCGAGATCTCCTTGGGTTTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-194s1c1
Sequence:CCGGGATACTCTGGAGGAAGCATTTCTCGAGAAATGCTTCCTCCAGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178547
VALIDATED
ZBTB8OS MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 8 opposite strand
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-194s21c1
Sequence:CCGGGATACTCTGGAGGAAGCATTTCTCGAGAAATGCTTCCTCCAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-120s21c1
Sequence:CCGGCCAAGTATCCGCCAGTCAATACTCGAGTATTGACTGGCGGATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-503s21c1
Sequence:CCGGGCAATGCAGGTCTATAATGAACTCGAGTTCATTATAGACCTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-284s21c1
Sequence:CCGGGAAGTAGAAACCCAAGGAGATCTCGAGATCTCCTTGGGTTTCTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-120s1c1
Sequence:CCGGCCAAGTATCCGCCAGTCAATACTCGAGTATTGACTGGCGGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-305s1c1
Sequence:CCGGGACTTACAGTCTCTTCTGTTTCTCGAGAAACAGAAGAGACTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178547.2-290s1c1
Sequence:CCGGGAAACCCAAGGAGATGACTTACTCGAGTAAGTCATCTCCTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178547.2-503s1c1
Sequence:CCGGGCAATGCAGGTCTATAATGAACTCGAGTTCATTATAGACCTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-284s1c1
Sequence:CCGGGAAGTAGAAACCCAAGGAGATCTCGAGATCTCCTTGGGTTTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-194s1c1
Sequence:CCGGGATACTCTGGAGGAAGCATTTCTCGAGAAATGCTTCCTCCAGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178547
VALIDATED
ZBTB8OS MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 8 opposite strand
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-194s21c1
Sequence:CCGGGATACTCTGGAGGAAGCATTTCTCGAGAAATGCTTCCTCCAGAGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-120s21c1
Sequence:CCGGCCAAGTATCCGCCAGTCAATACTCGAGTATTGACTGGCGGATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-503s21c1
Sequence:CCGGGCAATGCAGGTCTATAATGAACTCGAGTTCATTATAGACCTGCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178547.2-284s21c1
Sequence:CCGGGAAGTAGAAACCCAAGGAGATCTCGAGATCTCCTTGGGTTTCTACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-120s1c1
Sequence:CCGGCCAAGTATCCGCCAGTCAATACTCGAGTATTGACTGGCGGATACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-305s1c1
Sequence:CCGGGACTTACAGTCTCTTCTGTTTCTCGAGAAACAGAAGAGACTGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178547.2-290s1c1
Sequence:CCGGGAAACCCAAGGAGATGACTTACTCGAGTAAGTCATCTCCTTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178547.2-503s1c1
Sequence:CCGGGCAATGCAGGTCTATAATGAACTCGAGTTCATTATAGACCTGCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-284s1c1
Sequence:CCGGGAAGTAGAAACCCAAGGAGATCTCGAGATCTCCTTGGGTTTCTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_178547.2-194s1c1
Sequence:CCGGGATACTCTGGAGGAAGCATTTCTCGAGAAATGCTTCCTCCAGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025970
VALIDATED
ZBTB8OS MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 8 opposite strand
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-70s21c1
Sequence:CCGGAGGCGACCAAGGACAAGTATCCTCGAGGATACTTGTCCTTGGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-124s21c1
Sequence:CCGGATACGGCTGATGTCCAGTTACCTCGAGGTAACTGGACATCAGCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-341s21c1
Sequence:CCGGCCGGGAAGTGAAAGTACTTAACTCGAGTTAAGTACTTTCACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-500s21c1
Sequence:CCGGGTTTGTGATCATCGACATTTACTCGAGTAAATGTCGATGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.3-436s1c1
Sequence:CCGGGAACAGAAGTCAAGGCAATAACTCGAGTTATTGCCTTGACTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.3-342s1c1
Sequence:CCGGCGGGAAGTGAAAGTACTTAATCTCGAGATTAAGTACTTTCACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-458s21c1
Sequence:CCGGGTACTCAGCAATGCAAGTCTACTCGAGTAGACTTGCATTGCTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-124s1c1
Sequence:CCGGCATACGGCTGATGTCCAGTTACTCGAGTAACTGGACATCAGCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025970.1-459s1c1
Sequence:CCGGGTACTCAGCAATGCAAGTCTACTCGAGTAGACTTGCATTGCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-46s1c1
Sequence:CCGGGATTACAATTTGACGGAGGAACTCGAGTTCCTCCGTCAAATTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-274s1c1
Sequence:CCGGCAGTCTCTGCTGTTTCACTTTCTCGAGAAAGTGAAACAGCAGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-307s1c1
Sequence:CCGGCTTTACAAGTTCAGCGCTGATCTCGAGATCAGCGCTGAACTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.1-189s1c1
Sequence:CCGGCATGGCCATGTTTGGTTACATCTCGAGATGTAACCAAACATGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025970
VALIDATED
ZBTB8OS MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 8 opposite strand
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-70s21c1
Sequence:CCGGAGGCGACCAAGGACAAGTATCCTCGAGGATACTTGTCCTTGGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-124s21c1
Sequence:CCGGATACGGCTGATGTCCAGTTACCTCGAGGTAACTGGACATCAGCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-341s21c1
Sequence:CCGGCCGGGAAGTGAAAGTACTTAACTCGAGTTAAGTACTTTCACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-500s21c1
Sequence:CCGGGTTTGTGATCATCGACATTTACTCGAGTAAATGTCGATGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.3-436s1c1
Sequence:CCGGGAACAGAAGTCAAGGCAATAACTCGAGTTATTGCCTTGACTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.3-342s1c1
Sequence:CCGGCGGGAAGTGAAAGTACTTAATCTCGAGATTAAGTACTTTCACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-458s21c1
Sequence:CCGGGTACTCAGCAATGCAAGTCTACTCGAGTAGACTTGCATTGCTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-124s1c1
Sequence:CCGGCATACGGCTGATGTCCAGTTACTCGAGTAACTGGACATCAGCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025970.1-459s1c1
Sequence:CCGGGTACTCAGCAATGCAAGTCTACTCGAGTAGACTTGCATTGCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-46s1c1
Sequence:CCGGGATTACAATTTGACGGAGGAACTCGAGTTCCTCCGTCAAATTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-274s1c1
Sequence:CCGGCAGTCTCTGCTGTTTCACTTTCTCGAGAAAGTGAAACAGCAGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-307s1c1
Sequence:CCGGCTTTACAAGTTCAGCGCTGATCTCGAGATCAGCGCTGAACTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.1-189s1c1
Sequence:CCGGCATGGCCATGTTTGGTTACATCTCGAGATGTAACCAAACATGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025970
VALIDATED
ZBTB8OS MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 8 opposite strand
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-70s21c1
Sequence:CCGGAGGCGACCAAGGACAAGTATCCTCGAGGATACTTGTCCTTGGTCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-124s21c1
Sequence:CCGGATACGGCTGATGTCCAGTTACCTCGAGGTAACTGGACATCAGCCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-341s21c1
Sequence:CCGGCCGGGAAGTGAAAGTACTTAACTCGAGTTAAGTACTTTCACTTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-500s21c1
Sequence:CCGGGTTTGTGATCATCGACATTTACTCGAGTAAATGTCGATGATCACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215420    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.3-436s1c1
Sequence:CCGGGAACAGAAGTCAAGGCAATAACTCGAGTTATTGCCTTGACTTCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215857    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.3-342s1c1
Sequence:CCGGCGGGAAGTGAAAGTACTTAATCTCGAGATTAAGTACTTTCACTTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025970.3-458s21c1
Sequence:CCGGGTACTCAGCAATGCAAGTCTACTCGAGTAGACTTGCATTGCTGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-124s1c1
Sequence:CCGGCATACGGCTGATGTCCAGTTACTCGAGTAACTGGACATCAGCCGTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025970.1-459s1c1
Sequence:CCGGGTACTCAGCAATGCAAGTCTACTCGAGTAGACTTGCATTGCTGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-46s1c1
Sequence:CCGGGATTACAATTTGACGGAGGAACTCGAGTTCCTCCGTCAAATTGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-274s1c1
Sequence:CCGGCAGTCTCTGCTGTTTCACTTTCTCGAGAAAGTGAAACAGCAGAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025970.1-307s1c1
Sequence:CCGGCTTTACAAGTTCAGCGCTGATCTCGAGATCAGCGCTGAACTTGTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200929    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025970.1-189s1c1
Sequence:CCGGCATGGCCATGTTTGGTTACATCTCGAGATGTAACCAAACATGGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks