EMAIL THIS PAGE TO A FRIEND

ZBTB9

zinc finger and BTB domain containing 9

Synonyms: ZNF919
UniProtKB ID: Q96C00, A2AB19
Gene ID:
Mouse(474156) zinc finger and BTB domain containing 9
Rat(294289) zinc finger and BTB domain containing 9
dog(100688678) zinc finger and BTB domain containing 9
domestic cat(101093185) zinc finger and BTB domain containing 9
Horse(100061718) zinc finger and BTB domain containing 9
cow(539371) zinc finger and BTB domain containing 9
sheep(101114313) zinc finger and BTB domain containing 9
naked mole-rat(101708181) zinc finger and BTB domain containing 9
Domestic Rabbit(100354693) zinc finger and BTB domain containing 9
domestic guinea pig(100729465) zinc finger and BTB domain containing 9
114 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV39929 Anti-ZBTB9 (AB1) antibody produced in rabbit affinity isolated antibody mouse, guinea pig, canine, horse, rabbit, human
immunohistochemistry, western blot pricing
AV39930 Anti-ZBTB9 (AB2) antibody produced in rabbit affinity isolated antibody guinea pig, horse, human, mouse, rat
western blot pricing
HPA036767 Anti-ZBTB9 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2106234 Anti-ZBTB9 antibody produced in rabbit affinity isolated antibody rabbit, mouse, human, horse, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152735 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU153761 MISSION® esiRNA esiRNA targeting mouse Zbtb9 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152735 Rosetta Predictions human pricing
NM_213564 Rosetta Predictions rat pricing
NM_001005916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00152339 predicted 1522
2 SASI_Hs01_00152340 predicted 1927
3 SASI_Hs01_00152341 predicted 429
4 SASI_Hs02_00366652 predicted 1305
5 SASI_Hs01_00152343 predicted 1142
6 SASI_Hs01_00152344 predicted 653
7 SASI_Hs01_00152345 predicted 1907
8 SASI_Hs01_00152346 predicted 1762
9 SASI_Hs01_00152347 predicted 1695
10 SASI_Hs01_00152348 predicted 476
11 SASI_Hs01_00152342 predicted 1177
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270592 predicted 1521
2 SASI_Rn02_00270593 predicted 1260
3 SASI_Rn02_00270594 predicted 751
4 SASI_Rn02_00270595 predicted 1316
5 SASI_Rn02_00270596 predicted 535
6 SASI_Rn02_00270597 predicted 1295
7 SASI_Rn02_00270598 predicted 281
8 SASI_Rn02_00270599 predicted 351
9 SASI_Rn02_00270600 predicted 1636
10 SASI_Rn02_00270601 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286693 predicted 1254
2 SASI_Mm02_00286694 predicted 1555
3 SASI_Mm02_00286695 predicted 1352
4 SASI_Mm02_00286696 predicted 1677
5 SASI_Mm02_00286697 predicted 1122
6 SASI_Mm02_00286698 predicted 1016
7 SASI_Mm02_00286699 predicted 1418
8 SASI_Mm02_00286700 predicted 1560
9 SASI_Mm02_00286701 predicted 1402
10 SASI_Mm02_00286702 predicted 584
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005916
VALIDATED
ZBTB9 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-1430s1c1
Sequence:CCGGGCATCATCTAACAGAGCACATCTCGAGATGTGCTCTGTTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-2488s1c1
Sequence:CCGGGCCTTTCACTACCACTGATAACTCGAGTTATCAGTGGTAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005916.2-667s1c1
Sequence:CCGGGCCTCACACTTATTTCCACAACTCGAGTTGTGGAAATAAGTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005916.2-1358s1c1
Sequence:CCGGCCGACACATCATGTTGACGTTCTCGAGAACGTCAACATGATGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-1332s1c1
Sequence:CCGGCGGTTTGCAGTAAAGCCGAAACTCGAGTTTCGGCTTTACTGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005916
VALIDATED
ZBTB9 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-1430s1c1
Sequence:CCGGGCATCATCTAACAGAGCACATCTCGAGATGTGCTCTGTTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-2488s1c1
Sequence:CCGGGCCTTTCACTACCACTGATAACTCGAGTTATCAGTGGTAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005916.2-667s1c1
Sequence:CCGGGCCTCACACTTATTTCCACAACTCGAGTTGTGGAAATAAGTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005916.2-1358s1c1
Sequence:CCGGCCGACACATCATGTTGACGTTCTCGAGAACGTCAACATGATGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-1332s1c1
Sequence:CCGGCGGTTTGCAGTAAAGCCGAAACTCGAGTTTCGGCTTTACTGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005916
VALIDATED
ZBTB9 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-1430s1c1
Sequence:CCGGGCATCATCTAACAGAGCACATCTCGAGATGTGCTCTGTTAGATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125704    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-2488s1c1
Sequence:CCGGGCCTTTCACTACCACTGATAACTCGAGTTATCAGTGGTAGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005916.2-667s1c1
Sequence:CCGGGCCTCACACTTATTTCCACAACTCGAGTTGTGGAAATAAGTGTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005916.2-1358s1c1
Sequence:CCGGCCGACACATCATGTTGACGTTCTCGAGAACGTCAACATGATGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001005916.2-1332s1c1
Sequence:CCGGCGGTTTGCAGTAAAGCCGAAACTCGAGTTTCGGCTTTACTGCAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152735
VALIDATED
ZBTB9 MISSION shRNA Bacterial Glycerol Stock
zinc finger and BTB domain containing 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-656s1c1
Sequence:CCGGGCTCAGAAATTCTTAGAGAATCTCGAGATTCTCTAAGAATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152735.2-1510s1c1
Sequence:CCGGCGCTTCAAGCTGAAGCACCATCTCGAGATGGTGCTTCAGCTTGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-1288s1c1
Sequence:CCGGCCAGTGGATCTTCATGGGAATCTCGAGATTCCCATGAAGATCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152735.2-424s1c1
Sequence:CCGGCGGGAACTTAGGGCTCATAAACTCGAGTTTATGAGCCCTAAGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-462s1c1
Sequence:CCGGCTCTCCTTACTTCCATGACAACTCGAGTTGTCATGGAAGTAAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-874s21c1
Sequence:CCGGACTGGGAGAAGTGCTGCAAATCTCGAGATTTGCAGCACTTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-1301s21c1
Sequence:CCGGCCAGTGGATCTTCATGGGAATCTCGAGATTCCCATGAAGATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152735.3-811s21c1
Sequence:CCGGGTCCTCTGCTTCTACTGAAAGCTCGAGCTTTCAGTAGAAGCAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152735.3-560s21c1
Sequence:CCGGGGGCTGCTCCAGCTCATTTATCTCGAGATAAATGAGCTGGAGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-1794s21c1
Sequence:CCGGGCCAAGAGAATAGATACATTACTCGAGTAATGTATCTATTCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152735
VALIDATED
ZBTB9 MISSION shRNA shRNA Plasmid DNA
zinc finger and BTB domain containing 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-656s1c1
Sequence:CCGGGCTCAGAAATTCTTAGAGAATCTCGAGATTCTCTAAGAATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152735.2-1510s1c1
Sequence:CCGGCGCTTCAAGCTGAAGCACCATCTCGAGATGGTGCTTCAGCTTGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-1288s1c1
Sequence:CCGGCCAGTGGATCTTCATGGGAATCTCGAGATTCCCATGAAGATCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152735.2-424s1c1
Sequence:CCGGCGGGAACTTAGGGCTCATAAACTCGAGTTTATGAGCCCTAAGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-462s1c1
Sequence:CCGGCTCTCCTTACTTCCATGACAACTCGAGTTGTCATGGAAGTAAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-874s21c1
Sequence:CCGGACTGGGAGAAGTGCTGCAAATCTCGAGATTTGCAGCACTTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-1301s21c1
Sequence:CCGGCCAGTGGATCTTCATGGGAATCTCGAGATTCCCATGAAGATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152735.3-811s21c1
Sequence:CCGGGTCCTCTGCTTCTACTGAAAGCTCGAGCTTTCAGTAGAAGCAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152735.3-560s21c1
Sequence:CCGGGGGCTGCTCCAGCTCATTTATCTCGAGATAAATGAGCTGGAGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-1794s21c1
Sequence:CCGGGCCAAGAGAATAGATACATTACTCGAGTAATGTATCTATTCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152735
VALIDATED
ZBTB9 MISSION shRNA Lentiviral Transduction Particles
zinc finger and BTB domain containing 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017185    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-656s1c1
Sequence:CCGGGCTCAGAAATTCTTAGAGAATCTCGAGATTCTCTAAGAATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152735.2-1510s1c1
Sequence:CCGGCGCTTCAAGCTGAAGCACCATCTCGAGATGGTGCTTCAGCTTGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-1288s1c1
Sequence:CCGGCCAGTGGATCTTCATGGGAATCTCGAGATTCCCATGAAGATCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152735.2-424s1c1
Sequence:CCGGCGGGAACTTAGGGCTCATAAACTCGAGTTTATGAGCCCTAAGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152735.2-462s1c1
Sequence:CCGGCTCTCCTTACTTCCATGACAACTCGAGTTGTCATGGAAGTAAGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-874s21c1
Sequence:CCGGACTGGGAGAAGTGCTGCAAATCTCGAGATTTGCAGCACTTCTCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-1301s21c1
Sequence:CCGGCCAGTGGATCTTCATGGGAATCTCGAGATTCCCATGAAGATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152735.3-811s21c1
Sequence:CCGGGTCCTCTGCTTCTACTGAAAGCTCGAGCTTTCAGTAGAAGCAGAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152735.3-560s21c1
Sequence:CCGGGGGCTGCTCCAGCTCATTTATCTCGAGATAAATGAGCTGGAGCAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_152735.3-1794s21c1
Sequence:CCGGGCCAAGAGAATAGATACATTACTCGAGTAATGTATCTATTCTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks