EMAIL THIS PAGE TO A FRIEND

ZC2HC1A

zinc finger, C2HC-type containing 1A

Synonyms: C8orf70 FAM164A
UniProtKB ID: Q96GY0, Q9Y372
Gene ID:
Mouse(67306) zinc finger, C2HC-type containing 1A
Rat(310244) zinc finger, C2HC-type containing 1A
Zebrafish(324412) zinc finger, C2HC-type containing 1A
domestic cat(101090840) zinc finger, C2HC-type containing 1A
dog(487009) zinc finger, C2HC-type containing 1A
cow(516900) zinc finger, C2HC-type containing 1A
sheep(101111028) zinc finger, C2HC-type containing 1A
domestic guinea pig(100726084) zinc finger, C2HC-type containing 1A
naked mole-rat(101714592) zinc finger, C2HC-type containing 1A
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016010 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016010 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016010 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028401 MISSION® esiRNA esiRNA human FAM164A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016010 Rosetta Predictions human pricing
NM_001107661 Rosetta Predictions rat pricing
NM_173181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016010 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229447 predicted 241
2 SASI_Hs01_00229448 predicted 662
3 SASI_Hs01_00229449 predicted 300
4 SASI_Hs01_00229450 predicted 685
5 SASI_Hs01_00229451 predicted 553
6 SASI_Hs01_00229452 predicted 691
7 SASI_Hs01_00229453 predicted 349
8 SASI_Hs01_00229454 predicted 537
9 SASI_Hs01_00229456 predicted 449
10 SASI_Hs02_00348689 predicted 381
11 SASI_Hs01_00229455 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231025 predicted 400
2 SASI_Rn02_00231026 predicted 439
3 SASI_Rn02_00231027 predicted 898
4 SASI_Rn02_00231028 predicted 900
5 SASI_Rn02_00231029 predicted 769
6 SASI_Rn02_00231030 predicted 352
7 SASI_Rn02_00231031 predicted 266
8 SASI_Rn02_00231032 predicted 517
9 SASI_Rn02_00231033 predicted 889
10 SASI_Rn02_00231034 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096070 predicted 311
2 SASI_Mm01_00096071 predicted 688
3 SASI_Mm02_00345150 predicted 415
4 SASI_Mm01_00096072 predicted 615
5 SASI_Mm01_00096073 predicted 255
6 SASI_Mm01_00096075 predicted 381
7 SASI_Mm01_00096076 predicted 516
8 SASI_Mm01_00096077 predicted 859
9 SASI_Mm01_00096078 predicted 432
10 SASI_Mm01_00096079 predicted 325
11 SASI_Mm01_00096074 predicted 883
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016010
ZC2HC1A MISSION shRNA Bacterial Glycerol Stock
zinc finger, C2HC-type containing 1A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016010.2-1148s21c1
Sequence:CCGGGCACATCCTCTAGTTAGTTTGCTCGAGCAAACTAACTAGAGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016010.2-652s21c1
Sequence:CCGGTCATCAGGATCTTCACGATTACTCGAGTAATCGTGAAGATCCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016010.2-176s21c1
Sequence:CCGGCATTCTTTCCAGTAGCATTAACTCGAGTTAATGCTACTGGAAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-714s1c1
Sequence:CCGGGACCTTGTCTCCCTCTCATAACTCGAGTTATGAGAGGGAGACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-271s1c1
Sequence:CCGGCCACCAAAGAAACCATCTAATCTCGAGATTAGATGGTTTCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-887s1c1
Sequence:CCGGCTTCCCTTAATGGTGGAAATACTCGAGTATTTCCACCATTAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-953s1c1
Sequence:CCGGGCCATGAGTGTGGGACTAAATCTCGAGATTTAGTCCCACACTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016010.1-1057s1c1
Sequence:CCGGGCCAAGTTCAGAGTTTATGATCTCGAGATCATAAACTCTGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016010.1-487s1c1
Sequence:CCGGGCAGCACGTATTAGTAATGAACTCGAGTTCATTACTAATACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016010
ZC2HC1A MISSION shRNA shRNA Plasmid DNA
zinc finger, C2HC-type containing 1A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016010.2-1148s21c1
Sequence:CCGGGCACATCCTCTAGTTAGTTTGCTCGAGCAAACTAACTAGAGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016010.2-652s21c1
Sequence:CCGGTCATCAGGATCTTCACGATTACTCGAGTAATCGTGAAGATCCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016010.2-176s21c1
Sequence:CCGGCATTCTTTCCAGTAGCATTAACTCGAGTTAATGCTACTGGAAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-714s1c1
Sequence:CCGGGACCTTGTCTCCCTCTCATAACTCGAGTTATGAGAGGGAGACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-271s1c1
Sequence:CCGGCCACCAAAGAAACCATCTAATCTCGAGATTAGATGGTTTCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-887s1c1
Sequence:CCGGCTTCCCTTAATGGTGGAAATACTCGAGTATTTCCACCATTAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-953s1c1
Sequence:CCGGGCCATGAGTGTGGGACTAAATCTCGAGATTTAGTCCCACACTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016010.1-1057s1c1
Sequence:CCGGGCCAAGTTCAGAGTTTATGATCTCGAGATCATAAACTCTGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016010.1-487s1c1
Sequence:CCGGGCAGCACGTATTAGTAATGAACTCGAGTTCATTACTAATACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016010
ZC2HC1A MISSION shRNA Lentiviral Transduction Particles
zinc finger, C2HC-type containing 1A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427186    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016010.2-1148s21c1
Sequence:CCGGGCACATCCTCTAGTTAGTTTGCTCGAGCAAACTAACTAGAGGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016010.2-652s21c1
Sequence:CCGGTCATCAGGATCTTCACGATTACTCGAGTAATCGTGAAGATCCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016010.2-176s21c1
Sequence:CCGGCATTCTTTCCAGTAGCATTAACTCGAGTTAATGCTACTGGAAAGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-714s1c1
Sequence:CCGGGACCTTGTCTCCCTCTCATAACTCGAGTTATGAGAGGGAGACAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-271s1c1
Sequence:CCGGCCACCAAAGAAACCATCTAATCTCGAGATTAGATGGTTTCTTTGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-887s1c1
Sequence:CCGGCTTCCCTTAATGGTGGAAATACTCGAGTATTTCCACCATTAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016010.1-953s1c1
Sequence:CCGGGCCATGAGTGTGGGACTAAATCTCGAGATTTAGTCCCACACTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167406    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016010.1-1057s1c1
Sequence:CCGGGCCAAGTTCAGAGTTTATGATCTCGAGATCATAAACTCTGAACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166999    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016010.1-487s1c1
Sequence:CCGGGCAGCACGTATTAGTAATGAACTCGAGTTCATTACTAATACGTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173181
ZC2HC1A MISSION shRNA Bacterial Glycerol Stock
zinc finger, C2HC-type containing 1A
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-482s21c1
Sequence:CCGGTGCAGCCGACAGACATATAAACTCGAGTTTATATGTCTGTCGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-512s21c1
Sequence:CCGGAGAACAGGCAGCACGTATTAGCTCGAGCTAATACGTGCTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-250s21c1
Sequence:CCGGGAGCTGAAGGGACTGATATTCCTCGAGGAATATCAGTCCCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173181.3-2219s21c1
Sequence:CCGGTTACATAGCTGGCTAATATAACTCGAGTTATATTAGCCAGCTATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-848s1c1
Sequence:CCGGGAGACTATACATCTTCAGTTACTCGAGTAACTGAAGATGTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-155s1c1
Sequence:CCGGCCACTAAGAAGCGGAAGACTTCTCGAGAAGTCTTCCGCTTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-971s1c1
Sequence:CCGGGCTGTGAATGTGGCATTCGAACTCGAGTTCGAATGCCACATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173181
ZC2HC1A MISSION shRNA shRNA Plasmid DNA
zinc finger, C2HC-type containing 1A
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-482s21c1
Sequence:CCGGTGCAGCCGACAGACATATAAACTCGAGTTTATATGTCTGTCGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-512s21c1
Sequence:CCGGAGAACAGGCAGCACGTATTAGCTCGAGCTAATACGTGCTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-250s21c1
Sequence:CCGGGAGCTGAAGGGACTGATATTCCTCGAGGAATATCAGTCCCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173181.3-2219s21c1
Sequence:CCGGTTACATAGCTGGCTAATATAACTCGAGTTATATTAGCCAGCTATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-848s1c1
Sequence:CCGGGAGACTATACATCTTCAGTTACTCGAGTAACTGAAGATGTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-155s1c1
Sequence:CCGGCCACTAAGAAGCGGAAGACTTCTCGAGAAGTCTTCCGCTTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-971s1c1
Sequence:CCGGGCTGTGAATGTGGCATTCGAACTCGAGTTCGAATGCCACATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173181
ZC2HC1A MISSION shRNA Lentiviral Transduction Particles
zinc finger, C2HC-type containing 1A
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-482s21c1
Sequence:CCGGTGCAGCCGACAGACATATAAACTCGAGTTTATATGTCTGTCGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-512s21c1
Sequence:CCGGAGAACAGGCAGCACGTATTAGCTCGAGCTAATACGTGCTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244530    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173181.3-250s21c1
Sequence:CCGGGAGCTGAAGGGACTGATATTCCTCGAGGAATATCAGTCCCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173181.3-2219s21c1
Sequence:CCGGTTACATAGCTGGCTAATATAACTCGAGTTATATTAGCCAGCTATGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-848s1c1
Sequence:CCGGGAGACTATACATCTTCAGTTACTCGAGTAACTGAAGATGTATAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-155s1c1
Sequence:CCGGCCACTAAGAAGCGGAAGACTTCTCGAGAAGTCTTCCGCTTCTTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189763    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173181.1-971s1c1
Sequence:CCGGGCTGTGAATGTGGCATTCGAACTCGAGTTCGAATGCCACATTCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks