EMAIL THIS PAGE TO A FRIEND

ZC2HC1B

zinc finger, C2HC-type containing 1B

Synonyms: C6orf94 FAM164B dJ468K18.5
UniProtKB ID: Q5TFG8, B2RUZ7, Q5TFG9
Gene ID:
Mouse(75122) zinc finger, C2HC-type containing 1B
Rat(100361672) zinc finger, C2HC-type containing 1B
naked mole-rat(101720759) zinc finger, C2HC-type containing 1B
domestic guinea pig(100732462) zinc finger, C2HC-type containing 1B
cow(768003) zinc finger, C2HC-type containing 1B
sheep(101119142) zinc finger, C2HC-type containing 1B
domestic cat(101092184) zinc finger, C2HC-type containing 1B
dog(484017) zinc finger, C2HC-type containing 1B
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013623 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013623 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013623 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_125512 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_125512 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_125512 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU151191 MISSION® esiRNA esiRNA human C6orf94 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723038 Rosetta Predictions human pricing
XM_928657 Rosetta Predictions human pricing
XM_941265 Rosetta Predictions human pricing
XM_125512 Rosetta Predictions mouse pricing
XM_912218 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723038 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00452816 predicted 424
2 SASI_Hs02_00452817 predicted 922
3 SASI_Hs02_00452818 predicted 868
4 SASI_Hs02_00452819 predicted 534
5 SASI_Hs02_00452820 predicted 632
6 SASI_Hs02_00452821 predicted 571
7 SASI_Hs02_00452822 predicted 697
8 SASI_Hs02_00452823 predicted 467
9 SASI_Hs02_00452824 predicted 368
10 SASI_Hs02_00452825 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_928657 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00480903 predicted 440
2 SASI_Hs02_00480904 predicted 329
3 SASI_Hs02_00480905 predicted 468
4 SASI_Hs01_00267641 predicted 291
5 SASI_Hs01_00267642 predicted 385
6 SASI_Hs02_00480906 predicted 385
7 SASI_Hs02_00480907 predicted 376
8 SASI_Hs01_00267643 predicted 329
9 SASI_Hs01_00267644 predicted 453
10 SASI_Hs02_00480908 predicted 264
11 SASI_Hs01_00267637 predicted 425
12 SASI_Hs01_00267638 predicted 925
13 SASI_Hs01_00267639 predicted 858
14 SASI_Hs01_00267640 predicted 517
15 SASI_Hs01_00267645 predicted 459
16 SASI_Hs01_00267646 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_941265 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00484738 predicted 425
2 SASI_Hs02_00484739 predicted 918
3 SASI_Hs02_00484740 predicted 867
4 SASI_Hs02_00484741 predicted 525
5 SASI_Hs02_00484742 predicted 629
6 SASI_Hs02_00484743 predicted 572
7 SASI_Hs02_00484744 predicted 701
8 SASI_Hs02_00484745 predicted 463
9 SASI_Hs02_00484746 predicted 368
10 SASI_Hs02_00484747 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125512 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221161 predicted 762
2 SASI_Mm01_00221162 predicted 602
3 SASI_Mm01_00221163 predicted 740
4 SASI_Mm01_00221164 predicted 738
5 SASI_Mm01_00221165 predicted 342
6 SASI_Mm01_00221166 predicted 340
7 SASI_Mm02_00424091 predicted 439
8 SASI_Mm01_00221168 predicted 427
9 SASI_Mm01_00221169 predicted 386
10 SASI_Mm01_00221170 predicted 211
11 SASI_Mm01_00221167 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912218 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436871 predicted 761
2 SASI_Mm02_00436872 predicted 604
3 SASI_Mm02_00436873 predicted 746
4 SASI_Mm02_00436874 predicted 735
5 SASI_Mm02_00436875 predicted 347
6 SASI_Mm02_00436876 predicted 337
7 SASI_Mm02_00436877 predicted 436
8 SASI_Mm02_00436878 predicted 428
9 SASI_Mm02_00436879 predicted 378
10 SASI_Mm02_00436880 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013623
ZC2HC1B MISSION shRNA Bacterial Glycerol Stock
zinc finger, C2HC-type containing 1B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-253s1c1
Sequence:CCGGGCAAAGATTACAGGGCACTGACTCGAGTCAGTGCCCTGTAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-670s1c1
Sequence:CCGGCACGAATGAAGTCCCAACCAACTCGAGTTGGTTGGGACTTCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-129s1c1
Sequence:CCGGGCAATCAGGAATTGTTTCCCTCTCGAGAGGGAAACAATTCCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-499s1c1
Sequence:CCGGGCGACATACTAATTTCTGCAACTCGAGTTGCAGAAATTAGTATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-125s1c1
Sequence:CCGGGATGGCAATCAGGAATTGTTTCTCGAGAAACAATTCCTGATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-225s1c1
Sequence:CCGGGAAAGCGTAAACCTTTCAGTTCTCGAGAACTGAAAGGTTTACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-220s1c1
Sequence:CCGGCAACAGAAAGCGTAAACCTTTCTCGAGAAAGGTTTACGCTTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-176s1c1
Sequence:CCGGGCAGATGTTCTGGAAAGGCATCTCGAGATGCCTTTCCAGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-535s1c1
Sequence:CCGGCCGAGTCTTTAATCCAGCTCACTCGAGTGAGCTGGATTAAAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-278s1c1
Sequence:CCGGCCTACTGTGAAGAAGACTCCACTCGAGTGGAGTCTTCTTCACAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013623
ZC2HC1B MISSION shRNA shRNA Plasmid DNA
zinc finger, C2HC-type containing 1B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-253s1c1
Sequence:CCGGGCAAAGATTACAGGGCACTGACTCGAGTCAGTGCCCTGTAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-670s1c1
Sequence:CCGGCACGAATGAAGTCCCAACCAACTCGAGTTGGTTGGGACTTCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-129s1c1
Sequence:CCGGGCAATCAGGAATTGTTTCCCTCTCGAGAGGGAAACAATTCCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-499s1c1
Sequence:CCGGGCGACATACTAATTTCTGCAACTCGAGTTGCAGAAATTAGTATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-125s1c1
Sequence:CCGGGATGGCAATCAGGAATTGTTTCTCGAGAAACAATTCCTGATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-225s1c1
Sequence:CCGGGAAAGCGTAAACCTTTCAGTTCTCGAGAACTGAAAGGTTTACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-220s1c1
Sequence:CCGGCAACAGAAAGCGTAAACCTTTCTCGAGAAAGGTTTACGCTTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-176s1c1
Sequence:CCGGGCAGATGTTCTGGAAAGGCATCTCGAGATGCCTTTCCAGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-535s1c1
Sequence:CCGGCCGAGTCTTTAATCCAGCTCACTCGAGTGAGCTGGATTAAAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-278s1c1
Sequence:CCGGCCTACTGTGAAGAAGACTCCACTCGAGTGGAGTCTTCTTCACAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013623
ZC2HC1B MISSION shRNA Lentiviral Transduction Particles
zinc finger, C2HC-type containing 1B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138885    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-253s1c1
Sequence:CCGGGCAAAGATTACAGGGCACTGACTCGAGTCAGTGCCCTGTAATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-670s1c1
Sequence:CCGGCACGAATGAAGTCCCAACCAACTCGAGTTGGTTGGGACTTCATTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-129s1c1
Sequence:CCGGGCAATCAGGAATTGTTTCCCTCTCGAGAGGGAAACAATTCCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-499s1c1
Sequence:CCGGGCGACATACTAATTTCTGCAACTCGAGTTGCAGAAATTAGTATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136166    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-125s1c1
Sequence:CCGGGATGGCAATCAGGAATTGTTTCTCGAGAAACAATTCCTGATTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-225s1c1
Sequence:CCGGGAAAGCGTAAACCTTTCAGTTCTCGAGAACTGAAAGGTTTACGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135725    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-220s1c1
Sequence:CCGGCAACAGAAAGCGTAAACCTTTCTCGAGAAAGGTTTACGCTTTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137665    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-176s1c1
Sequence:CCGGGCAGATGTTCTGGAAAGGCATCTCGAGATGCCTTTCCAGAACATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138356    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001013623.1-535s1c1
Sequence:CCGGCCGAGTCTTTAATCCAGCTCACTCGAGTGAGCTGGATTAAAGACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001013623.1-278s1c1
Sequence:CCGGCCTACTGTGAAGAAGACTCCACTCGAGTGGAGTCTTCTTCACAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_125512
ZC2HC1B MISSION shRNA Bacterial Glycerol Stock
zinc finger, C2HC-type containing 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-177s21c1
Sequence:CCGGCATTCCCACTGTGGGTAAATCCTCGAGGATTTACCCACAGTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_125512.4-939s21c1
Sequence:CCGGGAGCCTCTATGTGGTAGTTAACTCGAGTTAACTACCACATAGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-392s21c1
Sequence:CCGGCCGCTGCCCAACGACATATTACTCGAGTAATATGTCGTTGGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-335s21c1
Sequence:CCGGCAACCTCCAACCCAGATTATACTCGAGTATAATCTGGGTTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-283s21c1
Sequence:CCGGCAATTCACTCTAGCCATTAAACTCGAGTTTAATGGCTAGAGTGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_125512
ZC2HC1B MISSION shRNA shRNA Plasmid DNA
zinc finger, C2HC-type containing 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-177s21c1
Sequence:CCGGCATTCCCACTGTGGGTAAATCCTCGAGGATTTACCCACAGTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_125512.4-939s21c1
Sequence:CCGGGAGCCTCTATGTGGTAGTTAACTCGAGTTAACTACCACATAGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-392s21c1
Sequence:CCGGCCGCTGCCCAACGACATATTACTCGAGTAATATGTCGTTGGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-335s21c1
Sequence:CCGGCAACCTCCAACCCAGATTATACTCGAGTATAATCTGGGTTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-283s21c1
Sequence:CCGGCAATTCACTCTAGCCATTAAACTCGAGTTTAATGGCTAGAGTGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_125512
ZC2HC1B MISSION shRNA Lentiviral Transduction Particles
zinc finger, C2HC-type containing 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-177s21c1
Sequence:CCGGCATTCCCACTGTGGGTAAATCCTCGAGGATTTACCCACAGTGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238762    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_125512.4-939s21c1
Sequence:CCGGGAGCCTCTATGTGGTAGTTAACTCGAGTTAACTACCACATAGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-392s21c1
Sequence:CCGGCCGCTGCCCAACGACATATTACTCGAGTAATATGTCGTTGGGCAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238761    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-335s21c1
Sequence:CCGGCAACCTCCAACCCAGATTATACTCGAGTATAATCTGGGTTGGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_125512.4-283s21c1
Sequence:CCGGCAATTCACTCTAGCCATTAAACTCGAGTTTAATGGCTAGAGTGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks