EMAIL THIS PAGE TO A FRIEND

ZC2HC1C

zinc finger, C2HC-type containing 1C

Synonyms: C14orf140 FAM164C
UniProtKB ID: Q53FD0, E9PJQ0, Q9BTA8, Q9H5S9
Gene ID:
Mouse(72350) zinc finger, C2HC-type containing 1C
Rat(314321) zinc finger, C2HC-type containing 1C
domestic cat(101097249) zinc finger, C2HC-type containing 1C
dog(480391) zinc finger, C2HC-type containing 1C
sheep(101107707) zinc finger, C2HC-type containing 1C
domestic guinea pig(100735940) zinc finger, C2HC-type containing 1C
naked mole-rat(101721759) zinc finger, C2HC-type containing 1C
99 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024643 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042430 Rosetta Predictions human pricing
NM_024643 Rosetta Predictions human pricing
NM_001014079 Rosetta Predictions rat pricing
NM_172414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309738 predicted 1211
2 SASI_Hs02_00309739 predicted 775
3 SASI_Hs02_00309740 predicted 1312
4 SASI_Hs02_00309741 predicted 258
5 SASI_Hs02_00309742 predicted 1234
6 SASI_Hs02_00309743 predicted 582
7 SASI_Hs02_00309744 predicted 1306
8 SASI_Hs02_00309745 predicted 508
9 SASI_Hs02_00309746 predicted 206
10 SASI_Hs02_00309747 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357031 predicted 1732
2 SASI_Hs01_00164276 predicted 772
3 SASI_Hs02_00357032 predicted 1824
4 SASI_Hs02_00357033 predicted 259
5 SASI_Hs02_00357034 predicted 1746
6 SASI_Hs01_00164279 predicted 586
7 SASI_Hs02_00357035 predicted 1824
8 SASI_Hs01_00164285 predicted 508
9 SASI_Hs02_00357036 predicted 209
10 SASI_Hs02_00357037 predicted 1826
11 SASI_Hs01_00164277 predicted 986
12 SASI_Hs01_00164278 predicted 402
13 SASI_Hs01_00164280 predicted 1070
14 SASI_Hs01_00164281 predicted 476
15 SASI_Hs01_00164282 predicted 931
16 SASI_Hs01_00164283 predicted 218
17 SASI_Hs01_00164284 predicted 1338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014079 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045810 predicted 635
2 SASI_Rn02_00201497 predicted 777
3 SASI_Rn01_00045812 predicted 878
4 SASI_Rn01_00045813 predicted 1368
5 SASI_Rn02_00201498 predicted 1436
6 SASI_Rn01_00045814 predicted 1130
7 SASI_Rn01_00045815 predicted 1610
8 SASI_Rn02_00201499 predicted 680
9 SASI_Rn01_00045816 predicted 1300
10 SASI_Rn01_00045817 predicted 513
11 SASI_Rn01_00045811 predicted 397
12 SASI_Rn01_00045818 predicted 721
13 SASI_Rn01_00045819 predicted 1669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058003 predicted 674
2 SASI_Mm01_00058004 predicted 928
3 SASI_Mm01_00058005 predicted 438
4 SASI_Mm01_00058006 predicted 1413
5 SASI_Mm01_00058007 predicted 686
6 SASI_Mm01_00058008 predicted 519
7 SASI_Mm01_00058009 predicted 231
8 SASI_Mm01_00058010 predicted 282
9 SASI_Mm01_00058011 predicted 1117
10 SASI_Mm01_00058012 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024643
ZC2HC1C MISSION shRNA Bacterial Glycerol Stock
zinc finger, C2HC-type containing 1C
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000419262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024643.2-1768s21c1
Sequence:CCGGATAGTTGAGCAGACAACAATGCTCGAGCATTGTTGTCTGCTCAACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024643.2-361s21c1
Sequence:CCGGTGATTCTGGATAAAGTCTATACTCGAGTATAGACTTTATCCAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024643.2-769s21c1
Sequence:CCGGAGAAGGCCGTGGCAAACTTTGCTCGAGCAAAGTTTGCCACGGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024643.1-168s1c1
Sequence:CCGGGCGTTATGCTCCCACATAATACTCGAGTATTATGTGGGAGCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-1115s1c1
Sequence:CCGGGCTGGTAGCAAGCAATAATAACTCGAGTTATTATTGCTTGCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024643.1-803s1c1
Sequence:CCGGGAAATCCGAAGAAAGCAGATTCTCGAGAATCTGCTTTCTTCGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-1068s1c1
Sequence:CCGGCCATTCCAGTTCTCTGATTATCTCGAGATAATCAGAGAACTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-987s1c1
Sequence:CCGGCCAGAATTTGAGTTTGAGGAACTCGAGTTCCTCAAACTCAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024643.1-215s1c1
Sequence:CCGGGCCAAGCAAGACTCTTATGAACTCGAGTTCATAAGAGTCTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024643.1-404s1c1
Sequence:CCGGCAGCAAGATCCAGAAAGTGATCTCGAGATCACTTTCTGGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024643
ZC2HC1C MISSION shRNA shRNA Plasmid DNA
zinc finger, C2HC-type containing 1C
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000419262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024643.2-1768s21c1
Sequence:CCGGATAGTTGAGCAGACAACAATGCTCGAGCATTGTTGTCTGCTCAACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024643.2-361s21c1
Sequence:CCGGTGATTCTGGATAAAGTCTATACTCGAGTATAGACTTTATCCAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024643.2-769s21c1
Sequence:CCGGAGAAGGCCGTGGCAAACTTTGCTCGAGCAAAGTTTGCCACGGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024643.1-168s1c1
Sequence:CCGGGCGTTATGCTCCCACATAATACTCGAGTATTATGTGGGAGCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-1115s1c1
Sequence:CCGGGCTGGTAGCAAGCAATAATAACTCGAGTTATTATTGCTTGCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024643.1-803s1c1
Sequence:CCGGGAAATCCGAAGAAAGCAGATTCTCGAGAATCTGCTTTCTTCGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-1068s1c1
Sequence:CCGGCCATTCCAGTTCTCTGATTATCTCGAGATAATCAGAGAACTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-987s1c1
Sequence:CCGGCCAGAATTTGAGTTTGAGGAACTCGAGTTCCTCAAACTCAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024643.1-215s1c1
Sequence:CCGGGCCAAGCAAGACTCTTATGAACTCGAGTTCATAAGAGTCTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024643.1-404s1c1
Sequence:CCGGCAGCAAGATCCAGAAAGTGATCTCGAGATCACTTTCTGGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024643
ZC2HC1C MISSION shRNA Lentiviral Transduction Particles
zinc finger, C2HC-type containing 1C
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000419262    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024643.2-1768s21c1
Sequence:CCGGATAGTTGAGCAGACAACAATGCTCGAGCATTGTTGTCTGCTCAACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024643.2-361s21c1
Sequence:CCGGTGATTCTGGATAAAGTCTATACTCGAGTATAGACTTTATCCAGAATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024643.2-769s21c1
Sequence:CCGGAGAAGGCCGTGGCAAACTTTGCTCGAGCAAAGTTTGCCACGGCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024643.1-168s1c1
Sequence:CCGGGCGTTATGCTCCCACATAATACTCGAGTATTATGTGGGAGCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134897    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-1115s1c1
Sequence:CCGGGCTGGTAGCAAGCAATAATAACTCGAGTTATTATTGCTTGCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024643.1-803s1c1
Sequence:CCGGGAAATCCGAAGAAAGCAGATTCTCGAGAATCTGCTTTCTTCGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-1068s1c1
Sequence:CCGGCCATTCCAGTTCTCTGATTATCTCGAGATAATCAGAGAACTGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133771    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024643.1-987s1c1
Sequence:CCGGCCAGAATTTGAGTTTGAGGAACTCGAGTTCCTCAAACTCAAATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024643.1-215s1c1
Sequence:CCGGGCCAAGCAAGACTCTTATGAACTCGAGTTCATAAGAGTCTTGCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135219    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024643.1-404s1c1
Sequence:CCGGCAGCAAGATCCAGAAAGTGATCTCGAGATCACTTTCTGGATCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172414
ZC2HC1C MISSION shRNA Bacterial Glycerol Stock
zinc finger, C2HC-type containing 1C
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.2-1128s1c1
Sequence:CCGGCTGATGGCCAGTAACAGTAAACTCGAGTTTACTGTTACTGGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-1499s1c1
Sequence:CCGGGAGACAGAAGCACGAGTCTTTCTCGAGAAAGACTCGTGCTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172414.1-2776s1c1
Sequence:CCGGCCACAGATGTTCAGAATTTAACTCGAGTTAAATTCTGAACATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.1-190s1c1
Sequence:CCGGGCGTTATGTTCCCACATAATACTCGAGTATTATGTGGGAACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-250s1c1
Sequence:CCGGCTTACGAACAAAGTGACTCTTCTCGAGAAGAGTCACTTTGTTCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-1414s1c1
Sequence:CCGGGCACAGAACTAGAGCAGTACTCTCGAGAGTACTGCTCTAGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.1-510s1c1
Sequence:CCGGGCAAATGACCAGGACTTCATTCTCGAGAATGAAGTCCTGGTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-924s1c1
Sequence:CCGGGAGCTACAAAGGATGGTACTACTCGAGTAGTACCATCCTTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172414
ZC2HC1C MISSION shRNA shRNA Plasmid DNA
zinc finger, C2HC-type containing 1C
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.2-1128s1c1
Sequence:CCGGCTGATGGCCAGTAACAGTAAACTCGAGTTTACTGTTACTGGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-1499s1c1
Sequence:CCGGGAGACAGAAGCACGAGTCTTTCTCGAGAAAGACTCGTGCTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172414.1-2776s1c1
Sequence:CCGGCCACAGATGTTCAGAATTTAACTCGAGTTAAATTCTGAACATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.1-190s1c1
Sequence:CCGGGCGTTATGTTCCCACATAATACTCGAGTATTATGTGGGAACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-250s1c1
Sequence:CCGGCTTACGAACAAAGTGACTCTTCTCGAGAAGAGTCACTTTGTTCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-1414s1c1
Sequence:CCGGGCACAGAACTAGAGCAGTACTCTCGAGAGTACTGCTCTAGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.1-510s1c1
Sequence:CCGGGCAAATGACCAGGACTTCATTCTCGAGAATGAAGTCCTGGTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-924s1c1
Sequence:CCGGGAGCTACAAAGGATGGTACTACTCGAGTAGTACCATCCTTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172414
ZC2HC1C MISSION shRNA Lentiviral Transduction Particles
zinc finger, C2HC-type containing 1C
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216976    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.2-1128s1c1
Sequence:CCGGCTGATGGCCAGTAACAGTAAACTCGAGTTTACTGTTACTGGCCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-1499s1c1
Sequence:CCGGGAGACAGAAGCACGAGTCTTTCTCGAGAAAGACTCGTGCTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172414.1-2776s1c1
Sequence:CCGGCCACAGATGTTCAGAATTTAACTCGAGTTAAATTCTGAACATCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.1-190s1c1
Sequence:CCGGGCGTTATGTTCCCACATAATACTCGAGTATTATGTGGGAACATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-250s1c1
Sequence:CCGGCTTACGAACAAAGTGACTCTTCTCGAGAAGAGTCACTTTGTTCGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-1414s1c1
Sequence:CCGGGCACAGAACTAGAGCAGTACTCTCGAGAGTACTGCTCTAGTTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172414.1-510s1c1
Sequence:CCGGGCAAATGACCAGGACTTCATTCTCGAGAATGAAGTCCTGGTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172414.1-924s1c1
Sequence:CCGGGAGCTACAAAGGATGGTACTACTCGAGTAGTACCATCCTTTGTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks