EMAIL THIS PAGE TO A FRIEND

ZC3H10

zinc finger CCCH-type containing 10

Synonyms: ZC3HDC10
UniProtKB ID: Q96K80
Gene ID:
Mouse(103284) zinc finger CCCH type containing 10
Rat(685928) zinc finger CCCH type containing 10
Zebrafish(404630) zinc finger CCCH-type containing 10
dog(481106) zinc finger CCCH-type containing 10
Horse(100059294) zinc finger CCCH-type containing 10
domestic cat(101085642) zinc finger CCCH-type containing 10
chicken(100858126) zinc finger CCCH-type containing 10
naked mole-rat(101720149) zinc finger CCCH-type containing 10
Domestic Rabbit(100349569) zinc finger CCCH-type containing 10
domestic guinea pig(100736047) zinc finger CCCH-type containing 10
cow(507466) zinc finger CCCH-type containing 10
sheep(101103392) zinc finger CCCH-type containing 10
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134003 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134003 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134003 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032786 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018801 MISSION® esiRNA esiRNA targeting human ZC3H10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032786 Rosetta Predictions human pricing
XM_001065797 Rosetta Predictions rat pricing
NM_134003 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214800 predicted 1007
2 SASI_Hs01_00214801 predicted 1021
3 SASI_Hs01_00214802 predicted 601
4 SASI_Hs01_00214803 predicted 440
5 SASI_Hs01_00214805 predicted 1511
6 SASI_Hs02_00360343 predicted 356
7 SASI_Hs01_00214806 predicted 1398
8 SASI_Hs01_00214807 predicted 1774
9 SASI_Hs01_00214808 predicted 372
10 SASI_Hs01_00214809 predicted 596
11 SASI_Hs01_00214804 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065797 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315374 predicted 1146
2 SASI_Rn02_00315375 predicted 722
3 SASI_Rn02_00315376 predicted 1138
4 SASI_Rn02_00315377 predicted 765
5 SASI_Rn02_00315378 predicted 486
6 SASI_Rn02_00315379 predicted 561
7 SASI_Rn02_00315380 predicted 699
8 SASI_Rn02_00315381 predicted 1102
9 SASI_Rn02_00315382 predicted 1723
10 SASI_Rn02_00315383 predicted 435
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134003 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145116 predicted 994
2 SASI_Mm01_00145117 predicted 1585
3 SASI_Mm01_00145118 predicted 1008
4 SASI_Mm01_00145119 predicted 350
5 SASI_Mm01_00145120 predicted 1732
6 SASI_Mm01_00145121 predicted 474
7 SASI_Mm01_00145122 predicted 332
8 SASI_Mm01_00145123 predicted 308
9 SASI_Mm01_00145124 predicted 759
10 SASI_Mm01_00145125 predicted 1480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134003
VALIDATED
ZC3H10 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 10
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-725s1c1
Sequence:CCGGCCGTCATGATCTCTATGACATCTCGAGATGTCATAGAGATCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-628s1c1
Sequence:CCGGGCAAGTTTCGTCACCTGCAAACTCGAGTTTGCAGGTGACGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-1408s1c1
Sequence:CCGGCCACTACTCCTATGGTGACTTCTCGAGAAGTCACCATAGGAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-353s1c1
Sequence:CCGGCATGAGTGAGGTATCCAATTTCTCGAGAAATTGGATACCTCACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134003.1-1897s21c1
Sequence:CCGGTCAGGAGCAAAGACCTCATATCTCGAGATATGAGGTCTTTGCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-353s21c1
Sequence:CCGGCATGAGTGAGGTATCCAATTTCTCGAGAAATTGGATACCTCACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134003.1-465s21c1
Sequence:CCGGGAGGATGAGGATGGCTATAAGCTCGAGCTTATAGCCATCCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-721s21c1
Sequence:CCGGGACGCCGTCATGATCTCTATGCTCGAGCATAGAGATCATGACGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-616s21c1
Sequence:CCGGGAGGAGCCAAGTGCAAGTTTCCTCGAGGAAACTTGCACTTGGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134003
VALIDATED
ZC3H10 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 10
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-725s1c1
Sequence:CCGGCCGTCATGATCTCTATGACATCTCGAGATGTCATAGAGATCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-628s1c1
Sequence:CCGGGCAAGTTTCGTCACCTGCAAACTCGAGTTTGCAGGTGACGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-1408s1c1
Sequence:CCGGCCACTACTCCTATGGTGACTTCTCGAGAAGTCACCATAGGAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-353s1c1
Sequence:CCGGCATGAGTGAGGTATCCAATTTCTCGAGAAATTGGATACCTCACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134003.1-1897s21c1
Sequence:CCGGTCAGGAGCAAAGACCTCATATCTCGAGATATGAGGTCTTTGCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-353s21c1
Sequence:CCGGCATGAGTGAGGTATCCAATTTCTCGAGAAATTGGATACCTCACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134003.1-465s21c1
Sequence:CCGGGAGGATGAGGATGGCTATAAGCTCGAGCTTATAGCCATCCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-721s21c1
Sequence:CCGGGACGCCGTCATGATCTCTATGCTCGAGCATAGAGATCATGACGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-616s21c1
Sequence:CCGGGAGGAGCCAAGTGCAAGTTTCCTCGAGGAAACTTGCACTTGGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134003
VALIDATED
ZC3H10 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 10
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179060    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-725s1c1
Sequence:CCGGCCGTCATGATCTCTATGACATCTCGAGATGTCATAGAGATCATGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-628s1c1
Sequence:CCGGGCAAGTTTCGTCACCTGCAAACTCGAGTTTGCAGGTGACGAAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184782    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-1408s1c1
Sequence:CCGGCCACTACTCCTATGGTGACTTCTCGAGAAGTCACCATAGGAGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217839    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134003.1-353s1c1
Sequence:CCGGCATGAGTGAGGTATCCAATTTCTCGAGAAATTGGATACCTCACTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134003.1-1897s21c1
Sequence:CCGGTCAGGAGCAAAGACCTCATATCTCGAGATATGAGGTCTTTGCTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-353s21c1
Sequence:CCGGCATGAGTGAGGTATCCAATTTCTCGAGAAATTGGATACCTCACTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134003.1-465s21c1
Sequence:CCGGGAGGATGAGGATGGCTATAAGCTCGAGCTTATAGCCATCCTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257043    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-721s21c1
Sequence:CCGGGACGCCGTCATGATCTCTATGCTCGAGCATAGAGATCATGACGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134003.1-616s21c1
Sequence:CCGGGAGGAGCCAAGTGCAAGTTTCCTCGAGGAAACTTGCACTTGGCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032786
ZC3H10 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-1409s1c1
Sequence:CCGGGAATCACAATGAGCCACACCACTCGAGTGGTGTGGCTCATTGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-742s1c1
Sequence:CCGGCGACGTCATGATCTCTATGATCTCGAGATCATAGAGATCATGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-933s1c1
Sequence:CCGGGAAGCGGGTAGAGGAGTTAAACTCGAGTTTAACTCCTCTACCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032786.1-1935s1c1
Sequence:CCGGCAGACAATTTGGGTCCTAGTTCTCGAGAACTAGGACCCAAATTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-743s1c1
Sequence:CCGGGACGTCATGATCTCTATGATACTCGAGTATCATAGAGATCATGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032786.1-1932s1c1
Sequence:CCGGCTTCAGACAATTTGGGTCCTACTCGAGTAGGACCCAAATTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032786.1-598s21c1
Sequence:CCGGGTCCCTATCTGCCGTGACTTTCTCGAGAAAGTCACGGCAGATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032786.1-1609s21c1
Sequence:CCGGCAAGAGACTACAAGGAGTATGCTCGAGCATACTCCTTGTAGTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032786.1-1016s21c1
Sequence:CCGGGCAATCAGGCCAAGGTCATAACTCGAGTTATGACCTTGGCCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032786
ZC3H10 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-1409s1c1
Sequence:CCGGGAATCACAATGAGCCACACCACTCGAGTGGTGTGGCTCATTGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-742s1c1
Sequence:CCGGCGACGTCATGATCTCTATGATCTCGAGATCATAGAGATCATGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-933s1c1
Sequence:CCGGGAAGCGGGTAGAGGAGTTAAACTCGAGTTTAACTCCTCTACCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032786.1-1935s1c1
Sequence:CCGGCAGACAATTTGGGTCCTAGTTCTCGAGAACTAGGACCCAAATTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-743s1c1
Sequence:CCGGGACGTCATGATCTCTATGATACTCGAGTATCATAGAGATCATGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032786.1-1932s1c1
Sequence:CCGGCTTCAGACAATTTGGGTCCTACTCGAGTAGGACCCAAATTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032786.1-598s21c1
Sequence:CCGGGTCCCTATCTGCCGTGACTTTCTCGAGAAAGTCACGGCAGATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032786.1-1609s21c1
Sequence:CCGGCAAGAGACTACAAGGAGTATGCTCGAGCATACTCCTTGTAGTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032786.1-1016s21c1
Sequence:CCGGGCAATCAGGCCAAGGTCATAACTCGAGTTATGACCTTGGCCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032786
ZC3H10 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-1409s1c1
Sequence:CCGGGAATCACAATGAGCCACACCACTCGAGTGGTGTGGCTCATTGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-742s1c1
Sequence:CCGGCGACGTCATGATCTCTATGATCTCGAGATCATAGAGATCATGACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162894    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-933s1c1
Sequence:CCGGGAAGCGGGTAGAGGAGTTAAACTCGAGTTTAACTCCTCTACCCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161822    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032786.1-1935s1c1
Sequence:CCGGCAGACAATTTGGGTCCTAGTTCTCGAGAACTAGGACCCAAATTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159260    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032786.1-743s1c1
Sequence:CCGGGACGTCATGATCTCTATGATACTCGAGTATCATAGAGATCATGACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162156    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_032786.1-1932s1c1
Sequence:CCGGCTTCAGACAATTTGGGTCCTACTCGAGTAGGACCCAAATTGTCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032786.1-598s21c1
Sequence:CCGGGTCCCTATCTGCCGTGACTTTCTCGAGAAAGTCACGGCAGATAGGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032786.1-1609s21c1
Sequence:CCGGCAAGAGACTACAAGGAGTATGCTCGAGCATACTCCTTGTAGTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032786.1-1016s21c1
Sequence:CCGGGCAATCAGGCCAAGGTCATAACTCGAGTTATGACCTTGGCCTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks