EMAIL THIS PAGE TO A FRIEND

ZC3H11A

zinc finger CCCH-type containing 11A

Synonyms: ZC3HDC11A
Gene ID:
Mouse(70579) zinc finger CCCH type containing 11A
Rat(360845) zinc finger CCCH-type containing 11A
cow(529699) zinc finger CCCH-type containing 11A
sheep(101111983) zinc finger CCCH-type containing 11A
domestic guinea pig(100725138) zinc finger CCCH-type containing 11A
Domestic Rabbit(100353453) zinc finger CCCH-type containing 11A
naked mole-rat(101698703) zinc finger CCCH-type containing 11A
chicken(421172) zinc finger CCCH-type containing 11A
dog(478932) zinc finger CCCH-type containing 11A
Horse(100049984) zinc finger CCCH-type containing 11A
domestic cat(101080680) zinc finger CCCH-type containing 11A
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014827 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144530 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144530 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144530 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015581 MISSION® esiRNA esiRNA targeting human ZC3H11A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014827 Rosetta Predictions human pricing
NM_001047902 Rosetta Predictions rat pricing
NM_144530 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014827 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346364 predicted 868
2 SASI_Hs02_00346365 predicted 2471
3 SASI_Hs02_00346366 predicted 2287
4 SASI_Hs01_00175865 predicted 2198
5 SASI_Hs02_00346367 predicted 2364
6 SASI_Hs02_00346368 predicted 1537
7 SASI_Hs02_00346369 predicted 1394
8 SASI_Hs02_00346370 predicted 1621
9 SASI_Hs02_00346371 predicted 1586
10 SASI_Hs02_00346372 predicted 2572
11 SASI_Hs01_00175864 predicted 4764
12 SASI_Hs01_00175866 predicted 5405
13 SASI_Hs01_00175867 predicted 5440
14 SASI_Hs01_00175868 predicted 4652
15 SASI_Hs01_00175869 predicted 5509
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047902 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206637 predicted 2420
2 SASI_Rn02_00206638 predicted 1115
3 SASI_Rn02_00206639 predicted 1881
4 SASI_Rn02_00206640 predicted 2140
5 SASI_Rn02_00206641 predicted 1265
6 SASI_Rn02_00206642 predicted 2002
7 SASI_Rn02_00206643 predicted 1469
8 SASI_Rn02_00206644 predicted 1095
9 SASI_Rn02_00206645 predicted 1341
10 SASI_Rn02_00206646 predicted 1629
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144530 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076089 predicted 1379
2 SASI_Mm01_00076090 predicted 1568
3 SASI_Mm02_00340053 predicted 439
4 SASI_Mm01_00076091 predicted 1662
5 SASI_Mm01_00076092 predicted 1875
6 SASI_Mm01_00076093 predicted 1914
7 SASI_Mm01_00076094 predicted 1722
8 SASI_Mm02_00340054 predicted 1502
9 SASI_Mm01_00076095 predicted 1570
10 SASI_Mm01_00076096 predicted 690
11 SASI_Mm01_00076097 predicted 2836
12 SASI_Mm01_00076098 predicted 2141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014827
VALIDATED
ZC3H11A MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 11A
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-772s21c1
Sequence:CCGGTCGGCACATGGAGATTGATAACTCGAGTTATCAATCTCCATGTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014827.4-863s21c1
Sequence:CCGGCATCACAATAGAGGACGATATCTCGAGATATCGTCCTCTATTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-1067s21c1
Sequence:CCGGACGCATCCACCAGTTGTAATTCTCGAGAATTACAACTGGTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-3119s21c1
Sequence:CCGGTTTACCTGAGATGATCATTTCCTCGAGGAAATGATCATCTCAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-1207s21c1
Sequence:CCGGCCGGAAACCTGCAGTCAATATCTCGAGATATTGACTGCAGGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014827.2-950s1c1
Sequence:CCGGGCGTTATGAAAGTAGAAAGTTCTCGAGAACTTTCTACTTTCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014827.2-722s1c1
Sequence:CCGGGCAGTGAAATTCCTTGTTATTCTCGAGAATAACAAGGAATTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-786s1c1
Sequence:CCGGCCATCACAATAGAGGACGATACTCGAGTATCGTCCTCTATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-1657s1c1
Sequence:CCGGCGTGGAGAATTGCAAACTAAACTCGAGTTTAGTTTGCAATTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-2138s1c1
Sequence:CCGGGCAGTATTAGAACAGAAGCTACTCGAGTAGCTTCTGTTCTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-2507s1c1
Sequence:CCGGCTGTGGTTAAAGTTGTGTCATCTCGAGATGACACAACTTTAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014827
VALIDATED
ZC3H11A MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 11A
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-772s21c1
Sequence:CCGGTCGGCACATGGAGATTGATAACTCGAGTTATCAATCTCCATGTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014827.4-863s21c1
Sequence:CCGGCATCACAATAGAGGACGATATCTCGAGATATCGTCCTCTATTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-1067s21c1
Sequence:CCGGACGCATCCACCAGTTGTAATTCTCGAGAATTACAACTGGTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-3119s21c1
Sequence:CCGGTTTACCTGAGATGATCATTTCCTCGAGGAAATGATCATCTCAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-1207s21c1
Sequence:CCGGCCGGAAACCTGCAGTCAATATCTCGAGATATTGACTGCAGGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014827.2-950s1c1
Sequence:CCGGGCGTTATGAAAGTAGAAAGTTCTCGAGAACTTTCTACTTTCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014827.2-722s1c1
Sequence:CCGGGCAGTGAAATTCCTTGTTATTCTCGAGAATAACAAGGAATTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-786s1c1
Sequence:CCGGCCATCACAATAGAGGACGATACTCGAGTATCGTCCTCTATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-1657s1c1
Sequence:CCGGCGTGGAGAATTGCAAACTAAACTCGAGTTTAGTTTGCAATTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-2138s1c1
Sequence:CCGGGCAGTATTAGAACAGAAGCTACTCGAGTAGCTTCTGTTCTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-2507s1c1
Sequence:CCGGCTGTGGTTAAAGTTGTGTCATCTCGAGATGACACAACTTTAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014827
VALIDATED
ZC3H11A MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 11A
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-772s21c1
Sequence:CCGGTCGGCACATGGAGATTGATAACTCGAGTTATCAATCTCCATGTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014827.4-863s21c1
Sequence:CCGGCATCACAATAGAGGACGATATCTCGAGATATCGTCCTCTATTGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-1067s21c1
Sequence:CCGGACGCATCCACCAGTTGTAATTCTCGAGAATTACAACTGGTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-3119s21c1
Sequence:CCGGTTTACCTGAGATGATCATTTCCTCGAGGAAATGATCATCTCAGGTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014827.4-1207s21c1
Sequence:CCGGCCGGAAACCTGCAGTCAATATCTCGAGATATTGACTGCAGGTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014827.2-950s1c1
Sequence:CCGGGCGTTATGAAAGTAGAAAGTTCTCGAGAACTTTCTACTTTCATAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014827.2-722s1c1
Sequence:CCGGGCAGTGAAATTCCTTGTTATTCTCGAGAATAACAAGGAATTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-786s1c1
Sequence:CCGGCCATCACAATAGAGGACGATACTCGAGTATCGTCCTCTATTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-1657s1c1
Sequence:CCGGCGTGGAGAATTGCAAACTAAACTCGAGTTTAGTTTGCAATTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-2138s1c1
Sequence:CCGGGCAGTATTAGAACAGAAGCTACTCGAGTAGCTTCTGTTCTAATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014827.2-2507s1c1
Sequence:CCGGCTGTGGTTAAAGTTGTGTCATCTCGAGATGACACAACTTTAACCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144530
ZC3H11A MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 11A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-1991s1c1
Sequence:CCGGCCCTTGGTTAGACTGAGTCTTCTCGAGAAGACTCAGTCTAACCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-2060s1c1
Sequence:CCGGCCTCCATTAAAGCGAAGCCTTCTCGAGAAGGCTTCGCTTTAATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-3065s1c1
Sequence:CCGGCCCAAAGTAAATGTGAAGCCACTCGAGTGGCTTCACATTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-2708s1c1
Sequence:CCGGGTGACTAAGATGGAGGCTAATCTCGAGATTAGCCTCCATCTTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144530
ZC3H11A MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 11A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-1991s1c1
Sequence:CCGGCCCTTGGTTAGACTGAGTCTTCTCGAGAAGACTCAGTCTAACCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-2060s1c1
Sequence:CCGGCCTCCATTAAAGCGAAGCCTTCTCGAGAAGGCTTCGCTTTAATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-3065s1c1
Sequence:CCGGCCCAAAGTAAATGTGAAGCCACTCGAGTGGCTTCACATTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-2708s1c1
Sequence:CCGGGTGACTAAGATGGAGGCTAATCTCGAGATTAGCCTCCATCTTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144530
ZC3H11A MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 11A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-1991s1c1
Sequence:CCGGCCCTTGGTTAGACTGAGTCTTCTCGAGAAGACTCAGTCTAACCAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-2060s1c1
Sequence:CCGGCCTCCATTAAAGCGAAGCCTTCTCGAGAAGGCTTCGCTTTAATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-3065s1c1
Sequence:CCGGCCCAAAGTAAATGTGAAGCCACTCGAGTGGCTTCACATTTACTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144530.3-2708s1c1
Sequence:CCGGGTGACTAAGATGGAGGCTAATCTCGAGATTAGCCTCCATCTTAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks