EMAIL THIS PAGE TO A FRIEND

ZC3H12A

zinc finger CCCH-type containing 12A

Synonyms: MCPIP MCPIP1 RP3-423B22.1 dJ423B22.1
UniProtKB ID: Q5D1E8, D3DPT0, Q6I9Z1, Q9H5P1
Gene ID:
Human(80149) Summary: ZC3H12A is an MCP1 (CCL2; MIM 158105)-induced protein that acts as a transcriptional activator and causes cell death of cardiomyocytes, possibly via induction of genes associated with apoptosis.[supplied by OMIM, Mar 2008]
Mouse(230738) zinc finger CCCH type containing 12A
Rat(313587) zinc finger CCCH type containing 12A
chicken(419618) zinc finger CCCH-type containing 12A
dog(608211) zinc finger CCCH-type containing 12A
domestic cat(101088347) zinc finger CCCH-type containing 12A
naked mole-rat(101726521) zinc finger CCCH-type containing 12A
domestic guinea pig(100729919) zinc finger CCCH-type containing 12A
cow(535344) zinc finger CCCH-type containing 12A
sheep(101118325) zinc finger CCCH-type containing 12A
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025079 Rosetta Predictions human pricing
NM_001077671 Rosetta Predictions rat pricing
NM_153159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041853 predicted 1908
2 SASI_Hs02_00357761 predicted 1556
3 SASI_Hs01_00041854 predicted 1002
4 SASI_Hs01_00041855 predicted 2082
5 SASI_Hs01_00041856 predicted 2090
6 SASI_Hs02_00357762 predicted 1031
7 SASI_Hs01_00041857 predicted 382
8 SASI_Hs01_00041858 predicted 2362
9 SASI_Hs01_00041859 predicted 1420
10 SASI_Hs02_00357763 predicted 1677
11 SASI_Hs01_00041852 predicted 2149
12 SASI_Hs01_00041860 predicted 1635
13 SASI_Hs01_00041861 predicted 513
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207832 predicted 1837
2 SASI_Rn02_00207833 predicted 259
3 SASI_Rn02_00207834 predicted 614
4 SASI_Rn02_00207835 predicted 1482
5 SASI_Rn02_00207836 predicted 956
6 SASI_Rn02_00207837 predicted 657
7 SASI_Rn02_00207838 predicted 1620
8 SASI_Rn02_00207839 predicted 1093
9 SASI_Rn02_00207840 predicted 963
10 SASI_Rn02_00207841 predicted 757
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154747 predicted 961
2 SASI_Mm01_00154748 predicted 1854
3 SASI_Mm01_00154749 predicted 1365
4 SASI_Mm01_00154750 predicted 1875
5 SASI_Mm01_00154751 predicted 656
6 SASI_Mm01_00154752 predicted 1101
7 SASI_Mm01_00154753 predicted 668
8 SASI_Mm01_00154754 predicted 1618
9 SASI_Mm01_00154755 predicted 1504
10 SASI_Mm01_00154756 predicted 1042
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025079
ZC3H12A MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 12A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-260s1c1
Sequence:CCGGGCAGATGAAGGTGGACTTCTTCTCGAGAAGAAGTCCACCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025079.1-2532s1c1
Sequence:CCGGCCATCCTTTATTCAGAGTCATCTCGAGATGACTCTGAATAAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-992s1c1
Sequence:CCGGGCGTAAGAAGCCACTCACTTTCTCGAGAAAGTGAGTGGCTTCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-1777s1c1
Sequence:CCGGCCAGCGTGTATACTAAGCTGTCTCGAGACAGCTTAGTATACACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025079.1-2053s1c1
Sequence:CCGGGAAACCCACAAACCAAAGATACTCGAGTATCTTTGGTTTGTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025079.1-1046s1c1
Sequence:CCGGGAAATGCACCTATGGGATCAACTCGAGTTGATCCCATAGGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025079.1-2521s1c1
Sequence:CCGGCTTCTTCTCCTCCATCCTTTACTCGAGTAAAGGATGGAGGAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025079.2-1482s21c1
Sequence:CCGGGAGCCAGATGTCGGAACTTTGCTCGAGCAAAGTTCCGACATCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025079.2-2188s21c1
Sequence:CCGGATTGTATCTCTGTAGTTTAAGCTCGAGCTTAAACTACAGAGATACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025079.2-1090s21c1
Sequence:CCGGTATGGGATCAAGTGCCGATTCCTCGAGGAATCGGCACTTGATCCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025079
ZC3H12A MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 12A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-260s1c1
Sequence:CCGGGCAGATGAAGGTGGACTTCTTCTCGAGAAGAAGTCCACCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025079.1-2532s1c1
Sequence:CCGGCCATCCTTTATTCAGAGTCATCTCGAGATGACTCTGAATAAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-992s1c1
Sequence:CCGGGCGTAAGAAGCCACTCACTTTCTCGAGAAAGTGAGTGGCTTCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-1777s1c1
Sequence:CCGGCCAGCGTGTATACTAAGCTGTCTCGAGACAGCTTAGTATACACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025079.1-2053s1c1
Sequence:CCGGGAAACCCACAAACCAAAGATACTCGAGTATCTTTGGTTTGTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025079.1-1046s1c1
Sequence:CCGGGAAATGCACCTATGGGATCAACTCGAGTTGATCCCATAGGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025079.1-2521s1c1
Sequence:CCGGCTTCTTCTCCTCCATCCTTTACTCGAGTAAAGGATGGAGGAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025079.2-1482s21c1
Sequence:CCGGGAGCCAGATGTCGGAACTTTGCTCGAGCAAAGTTCCGACATCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025079.2-2188s21c1
Sequence:CCGGATTGTATCTCTGTAGTTTAAGCTCGAGCTTAAACTACAGAGATACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025079.2-1090s21c1
Sequence:CCGGTATGGGATCAAGTGCCGATTCCTCGAGGAATCGGCACTTGATCCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025079
ZC3H12A MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 12A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-260s1c1
Sequence:CCGGGCAGATGAAGGTGGACTTCTTCTCGAGAAGAAGTCCACCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128209    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025079.1-2532s1c1
Sequence:CCGGCCATCCTTTATTCAGAGTCATCTCGAGATGACTCTGAATAAAGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-992s1c1
Sequence:CCGGGCGTAAGAAGCCACTCACTTTCTCGAGAAAGTGAGTGGCTTCTTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025079.1-1777s1c1
Sequence:CCGGCCAGCGTGTATACTAAGCTGTCTCGAGACAGCTTAGTATACACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025079.1-2053s1c1
Sequence:CCGGGAAACCCACAAACCAAAGATACTCGAGTATCTTTGGTTTGTGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129038    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025079.1-1046s1c1
Sequence:CCGGGAAATGCACCTATGGGATCAACTCGAGTTGATCCCATAGGTGCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025079.1-2521s1c1
Sequence:CCGGCTTCTTCTCCTCCATCCTTTACTCGAGTAAAGGATGGAGGAGAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025079.2-1482s21c1
Sequence:CCGGGAGCCAGATGTCGGAACTTTGCTCGAGCAAAGTTCCGACATCTGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431553    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025079.2-2188s21c1
Sequence:CCGGATTGTATCTCTGTAGTTTAAGCTCGAGCTTAAACTACAGAGATACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025079.2-1090s21c1
Sequence:CCGGTATGGGATCAAGTGCCGATTCCTCGAGGAATCGGCACTTGATCCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153159
ZC3H12A MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 12A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153159.1-621s1c1
Sequence:CCGGCCACACAGATATTACCGTGTTCTCGAGAACACGGTAATATCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153159.1-2603s1c1
Sequence:CCGGCCTGAGTTCAAATGTCAGCAACTCGAGTTGCTGACATTTGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153159.1-1749s1c1
Sequence:CCGGCAAAGAAAGGGCTGGTGTATACTCGAGTATACACCAGCCCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-1642s21c1
Sequence:CCGGTGGTCTGAGCCGTACCCATTACTCGAGTAATGGGTACGGCTCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-1048s21c1
Sequence:CCGGTATGGAATCAAGTGCCGATTTCTCGAGAAATCGGCACTTGATTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-776s21c1
Sequence:CCGGGCTATGATGACCGCTTCATTGCTCGAGCAATGAAGCGGTCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-614s21c1
Sequence:CCGGAGCGAGGCCACACAGATATTACTCGAGTAATATCTGTGTGGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153159.1-2482s21c1
Sequence:CCGGCTGTGTACAGAGGCGAGATTTCTCGAGAAATCTCGCCTCTGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153159
ZC3H12A MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 12A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153159.1-621s1c1
Sequence:CCGGCCACACAGATATTACCGTGTTCTCGAGAACACGGTAATATCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153159.1-2603s1c1
Sequence:CCGGCCTGAGTTCAAATGTCAGCAACTCGAGTTGCTGACATTTGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153159.1-1749s1c1
Sequence:CCGGCAAAGAAAGGGCTGGTGTATACTCGAGTATACACCAGCCCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-1642s21c1
Sequence:CCGGTGGTCTGAGCCGTACCCATTACTCGAGTAATGGGTACGGCTCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-1048s21c1
Sequence:CCGGTATGGAATCAAGTGCCGATTTCTCGAGAAATCGGCACTTGATTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-776s21c1
Sequence:CCGGGCTATGATGACCGCTTCATTGCTCGAGCAATGAAGCGGTCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-614s21c1
Sequence:CCGGAGCGAGGCCACACAGATATTACTCGAGTAATATCTGTGTGGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153159.1-2482s21c1
Sequence:CCGGCTGTGTACAGAGGCGAGATTTCTCGAGAAATCTCGCCTCTGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153159
ZC3H12A MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 12A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201115    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153159.1-621s1c1
Sequence:CCGGCCACACAGATATTACCGTGTTCTCGAGAACACGGTAATATCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201088    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153159.1-2603s1c1
Sequence:CCGGCCTGAGTTCAAATGTCAGCAACTCGAGTTGCTGACATTTGAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217025    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153159.1-1749s1c1
Sequence:CCGGCAAAGAAAGGGCTGGTGTATACTCGAGTATACACCAGCCCTTTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-1642s21c1
Sequence:CCGGTGGTCTGAGCCGTACCCATTACTCGAGTAATGGGTACGGCTCAGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-1048s21c1
Sequence:CCGGTATGGAATCAAGTGCCGATTTCTCGAGAAATCGGCACTTGATTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-776s21c1
Sequence:CCGGGCTATGATGACCGCTTCATTGCTCGAGCAATGAAGCGGTCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153159.1-614s21c1
Sequence:CCGGAGCGAGGCCACACAGATATTACTCGAGTAATATCTGTGTGGCCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238817    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153159.1-2482s21c1
Sequence:CCGGCTGTGTACAGAGGCGAGATTTCTCGAGAAATCTCGCCTCTGTACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks