EMAIL THIS PAGE TO A FRIEND

ZC3H12B

zinc finger CCCH-type containing 12B

Synonyms: CXorf32 MCPIP2
UniProtKB ID: Q5HYM0, B2RTQ3, Q5H9C0
Gene ID:
Human(340554) Summary: The protein encoded by this gene belongs to a family of CCCH-type zinc finger proteins that are involved in the proinflammatory activation of macrophages. The exact function of this family member is unknown, but it is thought to function as a ribonuclease. [provided by RefSeq, May 2010]
Mouse(547176) zinc finger CCCH-type containing 12B
Rat(296864) zinc finger CCCH-type containing 12B
cow(524199) zinc finger CCCH-type containing 12B
sheep(101112028) zinc finger CCCH-type containing 12B
domestic guinea pig(100733001) zinc finger CCCH-type containing 12B
naked mole-rat(101713956) zinc finger CCCH-type containing 12B
Domestic Rabbit(100356747) zinc finger CCCH-type containing 12B
Zebrafish(100270733) zinc finger CCCH-type containing 12B
chicken(422175) zinc finger CCCH-type containing 12B
domestic cat(101093258) zinc finger CCCH-type containing 12B
Horse(100065633) zinc finger CCCH-type containing 12B
dog(491921) zinc finger CCCH-type containing 12B
254 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001034907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001034907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001034907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001010888 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001010888 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001010888 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU074131 MISSION® esiRNA esiRNA human ZC3H12B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010888 Rosetta Predictions human pricing
XM_231446 Rosetta Predictions rat pricing
XR_008422 Rosetta Predictions rat pricing
NM_001034907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010888 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178307 predicted 623
2 SASI_Hs02_00305852 predicted 437
3 SASI_Hs01_00178310 predicted 2175
4 SASI_Hs01_00178311 predicted 1691
5 SASI_Hs01_00178312 predicted 1211
6 SASI_Hs01_00178313 predicted 665
7 SASI_Hs01_00178314 predicted 1771
8 SASI_Hs01_00178315 predicted 1869
9 SASI_Hs01_00178316 predicted 1553
10 SASI_Hs02_00305853 predicted 1963
11 SASI_Hs01_00178308 predicted 416
12 SASI_Hs01_00178309 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_231446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126911 predicted 1769
2 SASI_Rn01_00126912 predicted 740
3 SASI_Rn01_00126913 predicted 1752
4 SASI_Rn01_00126914 predicted 2213
5 SASI_Rn01_00126915 predicted 2342
6 SASI_Rn01_00126916 predicted 832
7 SASI_Rn01_00126917 predicted 1982
8 SASI_Rn01_00126918 predicted 1498
9 SASI_Rn01_00126919 predicted 1876
10 SASI_Rn01_00126920 predicted 1956
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172930 predicted 1514
2 SASI_Rn02_00416997 predicted 575
3 SASI_Rn01_00172933 predicted 1955
4 SASI_Rn01_00172934 predicted 2087
5 SASI_Rn02_00416998 predicted 435
6 SASI_Rn01_00172935 predicted 665
7 SASI_Rn02_00416999 predicted 1081
8 SASI_Rn02_00417000 predicted 1097
9 SASI_Rn02_00417001 predicted 271
10 SASI_Rn02_00417002 predicted 381
11 SASI_Rn01_00172931 predicted 578
12 SASI_Rn01_00172932 predicted 1504
13 SASI_Rn01_00172936 predicted 1738
14 SASI_Rn01_00172937 predicted 1245
15 SASI_Rn01_00172938 predicted 1629
16 SASI_Rn01_00172939 predicted 1706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289214 predicted 2525
2 SASI_Mm02_00289215 predicted 1703
3 SASI_Mm01_00167651 predicted 1320
4 SASI_Mm01_00167655 predicted 1445
5 SASI_Mm01_00167657 predicted 1683
6 SASI_Mm02_00289216 predicted 2206
7 SASI_Mm01_00167659 predicted 1021
8 SASI_Mm02_00289217 predicted 1710
9 SASI_Mm02_00289218 predicted 1256
10 SASI_Mm02_00289219 predicted 1392
11 SASI_Mm01_00167650 predicted 1427
12 SASI_Mm01_00167652 predicted 1418
13 SASI_Mm01_00167653 predicted 1370
14 SASI_Mm01_00167654 predicted 1554
15 SASI_Mm01_00167656 predicted 1411
16 SASI_Mm01_00167658 predicted 1589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001034907
ZC3H12B MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 12B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000254967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1247s21c1
Sequence:CCGGACTAGGCCCAGAATCACTTATCTCGAGATAAGTGATTCTGGGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1693s21c1
Sequence:CCGGATGATCGGTTCATAGTCAAATCTCGAGATTTGACTATGAACCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-3102s21c1
Sequence:CCGGAGCCTCATGCAACCGTGTTATCTCGAGATAACACGGTTGCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1602s21c1
Sequence:CCGGGATCAAGATATTCTACGTAAACTCGAGTTTACGTAGAATATCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001034907
ZC3H12B MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 12B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000254967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1247s21c1
Sequence:CCGGACTAGGCCCAGAATCACTTATCTCGAGATAAGTGATTCTGGGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1693s21c1
Sequence:CCGGATGATCGGTTCATAGTCAAATCTCGAGATTTGACTATGAACCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-3102s21c1
Sequence:CCGGAGCCTCATGCAACCGTGTTATCTCGAGATAACACGGTTGCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1602s21c1
Sequence:CCGGGATCAAGATATTCTACGTAAACTCGAGTTTACGTAGAATATCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001034907
ZC3H12B MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 12B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000254967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1247s21c1
Sequence:CCGGACTAGGCCCAGAATCACTTATCTCGAGATAAGTGATTCTGGGCCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1693s21c1
Sequence:CCGGATGATCGGTTCATAGTCAAATCTCGAGATTTGACTATGAACCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-3102s21c1
Sequence:CCGGAGCCTCATGCAACCGTGTTATCTCGAGATAACACGGTTGCATGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001034907.2-1602s21c1
Sequence:CCGGGATCAAGATATTCTACGTAAACTCGAGTTTACGTAGAATATCTTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001010888
ZC3H12B MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 12B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-1652s21c1
Sequence:CCGGGCATGCATAACCGAGAGTATTCTCGAGAATACTCTCGGTTATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-2470s21c1
Sequence:CCGGCTTAGGGCTGCACGTTGATATCTCGAGATATCAACGTGCAGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010888.2-4068s21c1
Sequence:CCGGTGTCCACCCTTTGGGTAATAACTCGAGTTATTACCCAAAGGGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-815s21c1
Sequence:CCGGATGACCGGTTCATAGTCAAACCTCGAGGTTTGACTATGAACCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-229s21c1
Sequence:CCGGTGCCTAGATCGTCCAAGTTTCCTCGAGGAAACTTGGACGATCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-2157s1c1
Sequence:CCGGCAATGATTCCAGGGAGCATATCTCGAGATATGCTCCCTGGAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-891s1c1
Sequence:CCGGGCAACCATGTCCTTATGGCAACTCGAGTTGCCATAAGGACATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-2043s1c1
Sequence:CCGGCCACTCCTATCCCTTGAGTAACTCGAGTTACTCAAGGGATAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001010888
ZC3H12B MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 12B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-1652s21c1
Sequence:CCGGGCATGCATAACCGAGAGTATTCTCGAGAATACTCTCGGTTATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-2470s21c1
Sequence:CCGGCTTAGGGCTGCACGTTGATATCTCGAGATATCAACGTGCAGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010888.2-4068s21c1
Sequence:CCGGTGTCCACCCTTTGGGTAATAACTCGAGTTATTACCCAAAGGGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-815s21c1
Sequence:CCGGATGACCGGTTCATAGTCAAACCTCGAGGTTTGACTATGAACCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-229s21c1
Sequence:CCGGTGCCTAGATCGTCCAAGTTTCCTCGAGGAAACTTGGACGATCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-2157s1c1
Sequence:CCGGCAATGATTCCAGGGAGCATATCTCGAGATATGCTCCCTGGAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-891s1c1
Sequence:CCGGGCAACCATGTCCTTATGGCAACTCGAGTTGCCATAAGGACATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-2043s1c1
Sequence:CCGGCCACTCCTATCCCTTGAGTAACTCGAGTTACTCAAGGGATAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001010888
ZC3H12B MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 12B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-1652s21c1
Sequence:CCGGGCATGCATAACCGAGAGTATTCTCGAGAATACTCTCGGTTATGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-2470s21c1
Sequence:CCGGCTTAGGGCTGCACGTTGATATCTCGAGATATCAACGTGCAGCCCTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242230    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001010888.2-4068s21c1
Sequence:CCGGTGTCCACCCTTTGGGTAATAACTCGAGTTATTACCCAAAGGGTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-815s21c1
Sequence:CCGGATGACCGGTTCATAGTCAAACCTCGAGGTTTGACTATGAACCGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001010888.2-229s21c1
Sequence:CCGGTGCCTAGATCGTCCAAGTTTCCTCGAGGAAACTTGGACGATCTAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-2157s1c1
Sequence:CCGGCAATGATTCCAGGGAGCATATCTCGAGATATGCTCCCTGGAATCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172544    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-891s1c1
Sequence:CCGGGCAACCATGTCCTTATGGCAACTCGAGTTGCCATAAGGACATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172337    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001010888.1-2043s1c1
Sequence:CCGGCCACTCCTATCCCTTGAGTAACTCGAGTTACTCAAGGGATAGGAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks