EMAIL THIS PAGE TO A FRIEND

ZC3H12C

zinc finger CCCH-type containing 12C

Synonyms: MCPIP3
UniProtKB ID: Q9C0D7
Gene ID:
Mouse(244871) zinc finger CCCH type containing 12C
Rat(315658) zinc finger CCCH type containing 12C
chicken(418963) zinc finger CCCH-type containing 12C
Horse(100070081) zinc finger CCCH-type containing 12C
domestic cat(101100750) zinc finger CCCH-type containing 12C
dog(489416) zinc finger CCCH-type containing 12C
Domestic Rabbit(100353395) zinc finger CCCH-type containing 12C
naked mole-rat(101713271) zinc finger CCCH-type containing 12C
domestic guinea pig(100718815) zinc finger CCCH-type containing 12C
cow(512586) zinc finger CCCH-type containing 12C
sheep(101106107) zinc finger CCCH-type containing 12C
247 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033390 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033390 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033390 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_146893 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_146893 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_146893 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033390 Rosetta Predictions human pricing
XM_370654 Rosetta Predictions human pricing
XM_931631 Rosetta Predictions human pricing
NM_001108146 Rosetta Predictions rat pricing
XM_146893 Rosetta Predictions mouse pricing
XM_917341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033390 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361248 predicted 436
2 SASI_Hs02_00361249 predicted 343
3 SASI_Hs02_00361250 predicted 1598
4 SASI_Hs02_00361251 predicted 245
5 SASI_Hs02_00361252 predicted 2548
6 SASI_Hs02_00361253 predicted 2415
7 SASI_Hs02_00361254 predicted 546
8 SASI_Hs02_00361255 predicted 2345
9 SASI_Hs02_00361256 predicted 1874
10 SASI_Hs02_00361257 predicted 2127
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_370654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00298908 predicted 1086
2 SASI_Hs01_00298909 predicted 2334
3 SASI_Hs01_00298910 predicted 976
4 SASI_Hs01_00298911 predicted 2542
5 SASI_Hs01_00298912 predicted 3282
6 SASI_Hs01_00298913 predicted 2213
7 SASI_Hs01_00298914 predicted 3158
8 SASI_Hs01_00298915 predicted 1286
9 SASI_Hs01_00298916 predicted 2614
10 SASI_Hs01_00298917 predicted 2866
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931631 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269373 predicted 302
2 SASI_Hs01_00269374 predicted 214
3 SASI_Hs01_00269375 predicted 1007
4 SASI_Hs01_00269376 predicted 1006
5 SASI_Hs01_00269377 predicted 758
6 SASI_Hs01_00269378 predicted 288
7 SASI_Hs01_00269379 predicted 754
8 SASI_Hs01_00269380 predicted 1157
9 SASI_Hs01_00269381 predicted 417
10 SASI_Hs01_00269382 predicted 478
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108146 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235814 predicted 1771
2 SASI_Rn02_00235815 predicted 1812
3 SASI_Rn02_00235816 predicted 1325
4 SASI_Rn02_00235817 predicted 2319
5 SASI_Rn02_00235818 predicted 1094
6 SASI_Rn02_00235819 predicted 1165
7 SASI_Rn02_00235820 predicted 1653
8 SASI_Rn02_00235821 predicted 618
9 SASI_Rn02_00235822 predicted 1477
10 SASI_Rn02_00235823 predicted 2456
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_146893 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254054 predicted 431
2 SASI_Mm01_00254056 predicted 1815
3 SASI_Mm01_00254057 predicted 1155
4 SASI_Mm02_00425332 predicted 2612
5 SASI_Mm01_00254058 predicted 2316
6 SASI_Mm01_00254059 predicted 249
7 SASI_Mm01_00254060 predicted 556
8 SASI_Mm02_00425333 predicted 2245
9 SASI_Mm01_00254061 predicted 1101
10 SASI_Mm01_00254062 predicted 2104
11 SASI_Mm01_00254055 predicted 1176
12 SASI_Mm01_00254063 predicted 1658
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_917341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00441094 predicted 422
2 SASI_Mm02_00441095 predicted 1818
3 SASI_Mm02_00441096 predicted 1157
4 SASI_Mm02_00441097 predicted 2613
5 SASI_Mm02_00441098 predicted 2319
6 SASI_Mm02_00441099 predicted 249
7 SASI_Mm02_00441100 predicted 560
8 SASI_Mm02_00441101 predicted 2246
9 SASI_Mm02_00441102 predicted 1095
10 SASI_Mm02_00441103 predicted 2105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033390
VALIDATED
ZC3H12C MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 12C
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033390.1-7117s21c1
Sequence:CCGGTACCTGTTTACACCCATTATTCTCGAGAATAATGGGTGTAAACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-1800s21c1
Sequence:CCGGACCTGTCGACATCGGATATTACTCGAGTAATATCCGATGTCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_033390.1-516s21c1
Sequence:CCGGACCTGATGTGGTGCGAGAATACTCGAGTATTCTCGCACCACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-247s21c1
Sequence:CCGGCCAAGTATGGATACCGTTAATCTCGAGATTAACGGTATCCATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000237943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-678s21c1
Sequence:CCGGTCAAACGGTTAGTACAATTAACTCGAGTTAATTGTACTAACCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033390
VALIDATED
ZC3H12C MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 12C
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033390.1-7117s21c1
Sequence:CCGGTACCTGTTTACACCCATTATTCTCGAGAATAATGGGTGTAAACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-1800s21c1
Sequence:CCGGACCTGTCGACATCGGATATTACTCGAGTAATATCCGATGTCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_033390.1-516s21c1
Sequence:CCGGACCTGATGTGGTGCGAGAATACTCGAGTATTCTCGCACCACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-247s21c1
Sequence:CCGGCCAAGTATGGATACCGTTAATCTCGAGATTAACGGTATCCATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000237943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-678s21c1
Sequence:CCGGTCAAACGGTTAGTACAATTAACTCGAGTTAATTGTACTAACCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033390
VALIDATED
ZC3H12C MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 12C
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033390.1-7117s21c1
Sequence:CCGGTACCTGTTTACACCCATTATTCTCGAGAATAATGGGTGTAAACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-1800s21c1
Sequence:CCGGACCTGTCGACATCGGATATTACTCGAGTAATATCCGATGTCGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_033390.1-516s21c1
Sequence:CCGGACCTGATGTGGTGCGAGAATACTCGAGTATTCTCGCACCACATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-247s21c1
Sequence:CCGGCCAAGTATGGATACCGTTAATCTCGAGATTAACGGTATCCATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000237943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033390.1-678s21c1
Sequence:CCGGTCAAACGGTTAGTACAATTAACTCGAGTTAATTGTACTAACCGTTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_146893
VALIDATED
ZC3H12C MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 12C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000225690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-525s21c1
Sequence:CCGGCCCTGATGTGGTTCGAGAATACTCGAGTATTCTCGAACCACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-1809s21c1
Sequence:CCGGCCCTGTTGACGTTGGATATTACTCGAGTAATATCCAACGTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_146893.6-5476s21c1
Sequence:GTACCGGAGAATTGGTCAGCTGATTAAACTCGAGTTTAATCAGCTGACCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-2435s21c1
Sequence:CCGGCGTACTCCTTACCCGATAATTCTCGAGAATTATCGGGTAAGGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000225691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_146893.6-1090s21c1
Sequence:CCGGTTTGAGTCCGATGGTATAATTCTCGAGAATTATACCATCGGACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_146893
VALIDATED
ZC3H12C MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 12C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000225690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-525s21c1
Sequence:CCGGCCCTGATGTGGTTCGAGAATACTCGAGTATTCTCGAACCACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-1809s21c1
Sequence:CCGGCCCTGTTGACGTTGGATATTACTCGAGTAATATCCAACGTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_146893.6-5476s21c1
Sequence:GTACCGGAGAATTGGTCAGCTGATTAAACTCGAGTTTAATCAGCTGACCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-2435s21c1
Sequence:CCGGCGTACTCCTTACCCGATAATTCTCGAGAATTATCGGGTAAGGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000225691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_146893.6-1090s21c1
Sequence:CCGGTTTGAGTCCGATGGTATAATTCTCGAGAATTATACCATCGGACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_146893
VALIDATED
ZC3H12C MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 12C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000225690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-525s21c1
Sequence:CCGGCCCTGATGTGGTTCGAGAATACTCGAGTATTCTCGAACCACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225692    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-1809s21c1
Sequence:CCGGCCCTGTTGACGTTGGATATTACTCGAGTAATATCCAACGTCAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219112    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_146893.6-5476s21c1
Sequence:GTACCGGAGAATTGGTCAGCTGATTAAACTCGAGTTTAATCAGCTGACCAATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_146893.6-2435s21c1
Sequence:CCGGCGTACTCCTTACCCGATAATTCTCGAGAATTATCGGGTAAGGAGTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000225691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_146893.6-1090s21c1
Sequence:CCGGTTTGAGTCCGATGGTATAATTCTCGAGAATTATACCATCGGACTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks