EMAIL THIS PAGE TO A FRIEND

ZC3H12D

zinc finger CCCH-type containing 12D

Synonyms: C6orf95 MCPIP4 TFL dJ281H8.1 p34
Gene ID:
Mouse(237256) zinc finger CCCH type containing 12D
Rat(308266) zinc finger CCCH type containing 12D
cow(615863) zinc finger CCCH-type containing 12D
sheep(101103988) zinc finger CCCH-type containing 12D
domestic guinea pig(100717632) zinc finger CCCH-type containing 12D
naked mole-rat(101720591) zinc finger CCCH-type containing 12D
chicken(421623) zinc finger CCCH-type containing 12D
dog(484029) zinc finger CCCH-type containing 12D
domestic cat(101081224) zinc finger CCCH-type containing 12D
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207360 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU069891 MISSION® esiRNA esiRNA targeting mouse Zc3h12d (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207360 Rosetta Predictions human pricing
XM_291154 Rosetta Predictions human pricing
XM_933939 Rosetta Predictions human pricing
XM_933941 Rosetta Predictions human pricing
NM_001107469 Rosetta Predictions rat pricing
NM_172785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00373916 predicted 520
2 SASI_Hs02_00373917 predicted 1106
3 SASI_Hs02_00373918 predicted 719
4 SASI_Hs02_00373919 predicted 497
5 SASI_Hs02_00373920 predicted 956
6 SASI_Hs02_00373921 predicted 779
7 SASI_Hs02_00373922 predicted 1324
8 SASI_Hs02_00373923 predicted 263
9 SASI_Hs02_00373924 predicted 859
10 SASI_Hs02_00373925 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_291154 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296384 predicted 615
2 SASI_Hs01_00296385 predicted 1207
3 SASI_Hs01_00296386 predicted 821
4 SASI_Hs01_00296387 predicted 587
5 SASI_Hs01_00296388 predicted 1046
6 SASI_Hs01_00296389 predicted 1426
7 SASI_Hs01_00296390 predicted 518
8 SASI_Hs01_00296391 predicted 296
9 SASI_Hs01_00296392 predicted 355
10 SASI_Hs01_00296393 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00288183 predicted 520
2 SASI_Hs01_00288184 predicted 710
3 SASI_Hs01_00288185 predicted 663
4 SASI_Hs01_00288186 predicted 502
5 SASI_Hs01_00288187 predicted 406
6 SASI_Hs01_00288188 predicted 656
7 SASI_Hs01_00288189 predicted 599
8 SASI_Hs01_00288190 predicted 653
9 SASI_Hs01_00288191 predicted 423
10 SASI_Hs01_00288192 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_933941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267952 predicted 2149
2 SASI_Hs01_00267953 predicted 2427
3 SASI_Hs01_00267954 predicted 1701
4 SASI_Hs01_00267955 predicted 2371
5 SASI_Hs01_00267956 predicted 2931
6 SASI_Hs01_00267957 predicted 2963
7 SASI_Hs01_00267958 predicted 2909
8 SASI_Hs01_00267959 predicted 2959
9 SASI_Hs01_00267960 predicted 2851
10 SASI_Hs01_00267961 predicted 2863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229135 predicted 1516
2 SASI_Rn02_00229136 predicted 1680
3 SASI_Rn02_00229137 predicted 1825
4 SASI_Rn02_00229138 predicted 463
5 SASI_Rn02_00229139 predicted 542
6 SASI_Rn02_00229140 predicted 402
7 SASI_Rn02_00229141 predicted 1410
8 SASI_Rn02_00229142 predicted 508
9 SASI_Rn02_00229143 predicted 1832
10 SASI_Rn02_00229144 predicted 250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192306 predicted 587
2 SASI_Mm01_00192307 predicted 593
3 SASI_Mm01_00192308 predicted 818
4 SASI_Mm01_00192309 predicted 1843
5 SASI_Mm01_00192310 predicted 642
6 SASI_Mm01_00192311 predicted 520
7 SASI_Mm01_00192312 predicted 924
8 SASI_Mm01_00192313 predicted 1390
9 SASI_Mm01_00192314 predicted 541
10 SASI_Mm01_00192315 predicted 1826
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207360
ZC3H12D MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 12D
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-819s21c1
Sequence:CCGGTTCGTCAACGACCGGTTCATGCTCGAGCATGAACCGGTCGTTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-955s21c1
Sequence:CCGGATGGCATCAAGTGCAAGTTCTCTCGAGAGAACTTGCACTTGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-523s21c1
Sequence:CCGGGAGGACACACCTACATCAAAGCTCGAGCTTTGATGTAGGTGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207360.1-1890s21c1
Sequence:CCGGGGTCGTAGTCAGAAGTTTAAACTCGAGTTTAAACTTCTGACTACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-918s21c1
Sequence:CCGGTCCTGGCAGCATTGTCCTTATCTCGAGATAAGGACAATGCTGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207360
ZC3H12D MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 12D
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-819s21c1
Sequence:CCGGTTCGTCAACGACCGGTTCATGCTCGAGCATGAACCGGTCGTTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-955s21c1
Sequence:CCGGATGGCATCAAGTGCAAGTTCTCTCGAGAGAACTTGCACTTGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-523s21c1
Sequence:CCGGGAGGACACACCTACATCAAAGCTCGAGCTTTGATGTAGGTGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207360.1-1890s21c1
Sequence:CCGGGGTCGTAGTCAGAAGTTTAAACTCGAGTTTAAACTTCTGACTACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-918s21c1
Sequence:CCGGTCCTGGCAGCATTGTCCTTATCTCGAGATAAGGACAATGCTGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207360
ZC3H12D MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 12D
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-819s21c1
Sequence:CCGGTTCGTCAACGACCGGTTCATGCTCGAGCATGAACCGGTCGTTGACGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-955s21c1
Sequence:CCGGATGGCATCAAGTGCAAGTTCTCTCGAGAGAACTTGCACTTGATGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-523s21c1
Sequence:CCGGGAGGACACACCTACATCAAAGCTCGAGCTTTGATGTAGGTGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239342    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207360.1-1890s21c1
Sequence:CCGGGGTCGTAGTCAGAAGTTTAAACTCGAGTTTAAACTTCTGACTACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207360.1-918s21c1
Sequence:CCGGTCCTGGCAGCATTGTCCTTATCTCGAGATAAGGACAATGCTGCCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172785
ZC3H12D MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 12D
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000216650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172785.2-2617s1c1
Sequence:CCGGCACCTTACAGAGATAAGATTCCTCGAGGAATCTTATCTCTGTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172785.2-1762s1c1
Sequence:CCGGCTTAGGAGACAGGTTCATAACCTCGAGGTTATGAACCTGTCTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172785.1-3744s1c1
Sequence:CCGGCCAGAAATACTCGGTTCATTTCTCGAGAAATGAACCGAGTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-604s1c1
Sequence:CCGGGATACTCCTATCAGAGAGCAACTCGAGTTGCTCTCTGATAGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-1515s1c1
Sequence:CCGGGCCCAGCTCCTATTGTTATCTCTCGAGAGATAACAATAGGAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-1195s1c1
Sequence:CCGGGCTTTGAATAGGAGCTTCGCTCTCGAGAGCGAAGCTCCTATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-828s1c1
Sequence:CCGGGCTCATGTTCTCCTTTGTAAACTCGAGTTTACAAAGGAGAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172785
ZC3H12D MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 12D
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000216650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172785.2-2617s1c1
Sequence:CCGGCACCTTACAGAGATAAGATTCCTCGAGGAATCTTATCTCTGTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172785.2-1762s1c1
Sequence:CCGGCTTAGGAGACAGGTTCATAACCTCGAGGTTATGAACCTGTCTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172785.1-3744s1c1
Sequence:CCGGCCAGAAATACTCGGTTCATTTCTCGAGAAATGAACCGAGTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-604s1c1
Sequence:CCGGGATACTCCTATCAGAGAGCAACTCGAGTTGCTCTCTGATAGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-1515s1c1
Sequence:CCGGGCCCAGCTCCTATTGTTATCTCTCGAGAGATAACAATAGGAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-1195s1c1
Sequence:CCGGGCTTTGAATAGGAGCTTCGCTCTCGAGAGCGAAGCTCCTATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-828s1c1
Sequence:CCGGGCTCATGTTCTCCTTTGTAAACTCGAGTTTACAAAGGAGAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172785
ZC3H12D MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 12D
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000216650    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172785.2-2617s1c1
Sequence:CCGGCACCTTACAGAGATAAGATTCCTCGAGGAATCTTATCTCTGTAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172785.2-1762s1c1
Sequence:CCGGCTTAGGAGACAGGTTCATAACCTCGAGGTTATGAACCTGTCTCCTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200637    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172785.1-3744s1c1
Sequence:CCGGCCAGAAATACTCGGTTCATTTCTCGAGAAATGAACCGAGTATTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192897    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-604s1c1
Sequence:CCGGGATACTCCTATCAGAGAGCAACTCGAGTTGCTCTCTGATAGGAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-1515s1c1
Sequence:CCGGGCCCAGCTCCTATTGTTATCTCTCGAGAGATAACAATAGGAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-1195s1c1
Sequence:CCGGGCTTTGAATAGGAGCTTCGCTCTCGAGAGCGAAGCTCCTATTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172785.1-828s1c1
Sequence:CCGGGCTCATGTTCTCCTTTGTAAACTCGAGTTTACAAAGGAGAACATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks