EMAIL THIS PAGE TO A FRIEND

ZC3H13

zinc finger CCCH-type containing 13

Synonyms: KIAA0853
Gene ID:
Mouse(67302) zinc finger CCCH type containing 13
Rat(305955) zinc finger CCCH type containing 13
Zebrafish(560041) zinc finger CCCH-type containing 13
chicken(418850) zinc finger CCCH-type containing 13
dog(485453) zinc finger CCCH-type containing 13
naked mole-rat(101711998) zinc finger CCCH-type containing 13
domestic guinea pig(100717222) zinc finger CCCH-type containing 13
cow(540735) zinc finger CCCH-type containing 13
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026083 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026083 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026083 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015070 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015070 Rosetta Predictions human pricing
XM_001072035 Rosetta Predictions rat pricing
XM_224295 Rosetta Predictions rat pricing
NM_026083 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108746 predicted 4543
2 SASI_Hs01_00108747 predicted 503
3 SASI_Hs01_00108748 predicted 4404
4 SASI_Hs01_00108749 predicted 1709
5 SASI_Hs01_00108751 predicted 560
6 SASI_Hs02_00346929 predicted 2747
7 SASI_Hs01_00108752 predicted 1512
8 SASI_Hs01_00108753 predicted 4456
9 SASI_Hs01_00108755 predicted 1512
10 SASI_Hs02_00346930 predicted 1820
11 SASI_Hs01_00108750 predicted 1307
12 SASI_Hs01_00108754 predicted 2627
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337514 predicted 2032
2 SASI_Rn02_00337515 predicted 4943
3 SASI_Rn02_00337516 predicted 1485
4 SASI_Rn02_00337517 predicted 4805
5 SASI_Rn02_00337518 predicted 2104
6 SASI_Rn02_00337519 predicted 783
7 SASI_Rn02_00337520 predicted 493
8 SASI_Rn02_00337521 predicted 4933
9 SASI_Rn02_00337522 predicted 755
10 SASI_Rn02_00337523 predicted 5249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00381889 predicted 1340
2 SASI_Rn02_00381890 predicted 4932
3 SASI_Rn02_00381891 predicted 1475
4 SASI_Rn02_00381892 predicted 4797
5 SASI_Rn02_00381893 predicted 2094
6 SASI_Rn02_00381894 predicted 926
7 SASI_Rn02_00381895 predicted 777
8 SASI_Rn02_00381896 predicted 489
9 SASI_Rn02_00381897 predicted 739
10 SASI_Rn02_00381898 predicted 5240
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026083 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078801 predicted 4810
2 SASI_Mm02_00329661 predicted 5370
3 SASI_Mm02_00329662 predicted 746
4 SASI_Mm01_00078803 predicted 3122
5 SASI_Mm02_00329663 predicted 1650
6 SASI_Mm01_00078804 predicted 2009
7 SASI_Mm01_00078805 predicted 4116
8 SASI_Mm01_00078807 predicted 4935
9 SASI_Mm01_00078808 predicted 2046
10 SASI_Mm01_00078809 predicted 5531
11 SASI_Mm01_00078802 predicted 1370
12 SASI_Mm01_00078806 predicted 764
13 SASI_Mm01_00078810 predicted 2129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026083
VALIDATED
ZC3H13 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 13
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-422s1c1
Sequence:CCGGGAATCTTCAAGAGGGAGACATCTCGAGATGTCTCCCTCTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026083.1-228s1c1
Sequence:CCGGGCTGCCTCTATGGAAACACATCTCGAGATGTGTTTCCATAGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-527s1c1
Sequence:CCGGGATTCTGACAATGGAGATATTCTCGAGAATATCTCCATTGTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-1059s1c1
Sequence:CCGGCTTCTAGACATCACTCGTCATCTCGAGATGACGAGTGATGTCTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.1-280s1c1
Sequence:CCGGGAAAGGCTACAGCAGCAATTACTCGAGTAATTGCTGCTGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026083.1-117s1c1
Sequence:CCGGCCAAGACCATATCTGAGAGTACTCGAGTACTCTCAGATATGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.2-3483s1c1
Sequence:CCGGCATGAGGATAGTCAGGTATTTCTCGAGAAATACCTGACTATCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026083.2-5632s1c1
Sequence:CCGGGACACGTGCTTTGGTTCATTTCTCGAGAAATGAACCAAAGCACGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.2-5373s1c1
Sequence:CCGGCGGCTAAGTCTTCGGTTATTTCTCGAGAAATAACCGAAGACTTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026083
VALIDATED
ZC3H13 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 13
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-422s1c1
Sequence:CCGGGAATCTTCAAGAGGGAGACATCTCGAGATGTCTCCCTCTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026083.1-228s1c1
Sequence:CCGGGCTGCCTCTATGGAAACACATCTCGAGATGTGTTTCCATAGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-527s1c1
Sequence:CCGGGATTCTGACAATGGAGATATTCTCGAGAATATCTCCATTGTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-1059s1c1
Sequence:CCGGCTTCTAGACATCACTCGTCATCTCGAGATGACGAGTGATGTCTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.1-280s1c1
Sequence:CCGGGAAAGGCTACAGCAGCAATTACTCGAGTAATTGCTGCTGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026083.1-117s1c1
Sequence:CCGGCCAAGACCATATCTGAGAGTACTCGAGTACTCTCAGATATGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.2-3483s1c1
Sequence:CCGGCATGAGGATAGTCAGGTATTTCTCGAGAAATACCTGACTATCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026083.2-5632s1c1
Sequence:CCGGGACACGTGCTTTGGTTCATTTCTCGAGAAATGAACCAAAGCACGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.2-5373s1c1
Sequence:CCGGCGGCTAAGTCTTCGGTTATTTCTCGAGAAATAACCGAAGACTTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026083
VALIDATED
ZC3H13 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 13
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-422s1c1
Sequence:CCGGGAATCTTCAAGAGGGAGACATCTCGAGATGTCTCCCTCTTGAAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026083.1-228s1c1
Sequence:CCGGGCTGCCTCTATGGAAACACATCTCGAGATGTGTTTCCATAGAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-527s1c1
Sequence:CCGGGATTCTGACAATGGAGATATTCTCGAGAATATCTCCATTGTCAGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026083.1-1059s1c1
Sequence:CCGGCTTCTAGACATCACTCGTCATCTCGAGATGACGAGTGATGTCTAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.1-280s1c1
Sequence:CCGGGAAAGGCTACAGCAGCAATTACTCGAGTAATTGCTGCTGTAGCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026083.1-117s1c1
Sequence:CCGGCCAAGACCATATCTGAGAGTACTCGAGTACTCTCAGATATGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.2-3483s1c1
Sequence:CCGGCATGAGGATAGTCAGGTATTTCTCGAGAAATACCTGACTATCCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026083.2-5632s1c1
Sequence:CCGGGACACGTGCTTTGGTTCATTTCTCGAGAAATGAACCAAAGCACGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026083.2-5373s1c1
Sequence:CCGGCGGCTAAGTCTTCGGTTATTTCTCGAGAAATAACCGAAGACTTAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015070
VALIDATED
ZC3H13 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-1183s1c1
Sequence:CCGGCCTCTCCTTATCCTTCACATTCTCGAGAATGTGAAGGATAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-4408s1c1
Sequence:CCGGCCAAGTTAGATGATGCACATTCTCGAGAATGTGCATCATCTAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015070.2-872s1c1
Sequence:CCGGCCCTCCTATACCAGAAGATATCTCGAGATATCTTCTGGTATAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-1075s1c1
Sequence:CCGGCCTCACAATCAGGATCATCTACTCGAGTAGATGATCCTGATTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-3550s1c1
Sequence:CCGGGCCACAGAACACGAGTAGAAACTCGAGTTTCTACTCGTGTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015070.3-5257s21c1
Sequence:CCGGGTCTAAAGAAATTGGGTATTTCTCGAGAAATACCCAATTTCTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015070.3-1680s21c1
Sequence:CCGGGAAAGTTCTCGTACGGAAATACTCGAGTATTTCCGTACGAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015070.3-1075s21c1
Sequence:CCGGCCTCACAATCAGGATCATCTACTCGAGTAGATGATCCTGATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015070.3-1617s21c1
Sequence:CCGGCATCGAAAGGAGGATACATATCTCGAGATATGTATCCTCCTTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015070.3-1819s21c1
Sequence:CCGGTTGATAGTCACAGTAGTAATACTCGAGTATTACTACTGTGACTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015070
VALIDATED
ZC3H13 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-1183s1c1
Sequence:CCGGCCTCTCCTTATCCTTCACATTCTCGAGAATGTGAAGGATAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-4408s1c1
Sequence:CCGGCCAAGTTAGATGATGCACATTCTCGAGAATGTGCATCATCTAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015070.2-872s1c1
Sequence:CCGGCCCTCCTATACCAGAAGATATCTCGAGATATCTTCTGGTATAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-1075s1c1
Sequence:CCGGCCTCACAATCAGGATCATCTACTCGAGTAGATGATCCTGATTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-3550s1c1
Sequence:CCGGGCCACAGAACACGAGTAGAAACTCGAGTTTCTACTCGTGTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015070.3-5257s21c1
Sequence:CCGGGTCTAAAGAAATTGGGTATTTCTCGAGAAATACCCAATTTCTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015070.3-1680s21c1
Sequence:CCGGGAAAGTTCTCGTACGGAAATACTCGAGTATTTCCGTACGAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015070.3-1075s21c1
Sequence:CCGGCCTCACAATCAGGATCATCTACTCGAGTAGATGATCCTGATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015070.3-1617s21c1
Sequence:CCGGCATCGAAAGGAGGATACATATCTCGAGATATGTATCCTCCTTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015070.3-1819s21c1
Sequence:CCGGTTGATAGTCACAGTAGTAATACTCGAGTATTACTACTGTGACTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015070
VALIDATED
ZC3H13 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-1183s1c1
Sequence:CCGGCCTCTCCTTATCCTTCACATTCTCGAGAATGTGAAGGATAAGGAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-4408s1c1
Sequence:CCGGCCAAGTTAGATGATGCACATTCTCGAGAATGTGCATCATCTAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015070.2-872s1c1
Sequence:CCGGCCCTCCTATACCAGAAGATATCTCGAGATATCTTCTGGTATAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-1075s1c1
Sequence:CCGGCCTCACAATCAGGATCATCTACTCGAGTAGATGATCCTGATTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015070.2-3550s1c1
Sequence:CCGGGCCACAGAACACGAGTAGAAACTCGAGTTTCTACTCGTGTTCTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274369    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015070.3-5257s21c1
Sequence:CCGGGTCTAAAGAAATTGGGTATTTCTCGAGAAATACCCAATTTCTTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015070.3-1680s21c1
Sequence:CCGGGAAAGTTCTCGTACGGAAATACTCGAGTATTTCCGTACGAGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_015070.3-1075s21c1
Sequence:CCGGCCTCACAATCAGGATCATCTACTCGAGTAGATGATCCTGATTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015070.3-1617s21c1
Sequence:CCGGCATCGAAAGGAGGATACATATCTCGAGATATGTATCCTCCTTTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015070.3-1819s21c1
Sequence:CCGGTTGATAGTCACAGTAGTAATACTCGAGTATTACTACTGTGACTATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks