EMAIL THIS PAGE TO A FRIEND

ZC3H14

zinc finger CCCH-type containing 14

Synonyms: MSUT-2 NY-REN-37 SUT2 UKp68
Gene ID:
Human(79882) Summary: ZC3H14 belongs to a family of poly(A)-binding proteins that influence gene expression by regulating mRNA stability, nuclear export, and translation (Kelly et al., 2007 [PubMed 17630287]
Mouse(75553) zinc finger CCCH type containing 14
Rat(192359) zinc finger CCCH type containing 14
cow(511473) zinc finger CCCH-type containing 14
sheep(101119222) zinc finger CCCH-type containing 14
domestic guinea pig(100732582) zinc finger CCCH-type containing 14
naked mole-rat(101718738) zinc finger CCCH-type containing 14
Zebrafish(562846) zinc finger CCCH-type containing 14
chicken(423399) zinc finger CCCH-type containing 14
Horse(100062155) zinc finger CCCH-type containing 14
domestic cat(101092192) zinc finger CCCH-type containing 14
dog(480412) zinc finger CCCH-type containing 14
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024824 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024824 Rosetta Predictions human pricing
NM_207660 Rosetta Predictions human pricing
NM_207661 Rosetta Predictions human pricing
NM_207662 Rosetta Predictions human pricing
NM_001033951 Rosetta Predictions rat pricing
NM_138920 Rosetta Predictions rat pricing
NM_001008506 Rosetta Predictions mouse pricing
NM_029334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238515 predicted 2589
2 SASI_Hs01_00238516 predicted 2382
3 SASI_Hs01_00238517 predicted 2424
4 SASI_Hs01_00238518 predicted 2408
5 SASI_Hs01_00238519 predicted 2587
6 SASI_Hs01_00238520 predicted 2655
7 SASI_Hs01_00238521 predicted 2644
8 SASI_Hs01_00238522 predicted 2597
9 SASI_Hs01_00238523 predicted 2728
10 SASI_Hs01_00238524 predicted 2525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149197 predicted 2118
2 SASI_Hs01_00149198 predicted 1915
3 SASI_Hs01_00149199 predicted 1962
4 SASI_Hs01_00149200 predicted 1939
5 SASI_Hs01_00149201 predicted 2126
6 SASI_Hs01_00149202 predicted 2190
7 SASI_Hs01_00149203 predicted 2180
8 SASI_Hs01_00149204 predicted 2129
9 SASI_Hs01_00149205 predicted 2270
10 SASI_Hs01_00149206 predicted 2060
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207661 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114192 predicted 2111
2 SASI_Hs01_00114193 predicted 1906
3 SASI_Hs01_00114194 predicted 1945
4 SASI_Hs01_00114195 predicted 1930
5 SASI_Hs01_00114196 predicted 2108
6 SASI_Hs01_00114197 predicted 2182
7 SASI_Hs01_00114198 predicted 2166
8 SASI_Hs01_00114199 predicted 2115
9 SASI_Hs01_00114200 predicted 2251
10 SASI_Hs01_00114201 predicted 2047
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207662 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079120 predicted 1465
2 SASI_Hs01_00079121 predicted 1253
3 SASI_Hs01_00079122 predicted 1305
4 SASI_Hs01_00079123 predicted 1285
5 SASI_Hs01_00079124 predicted 1463
6 SASI_Hs01_00079125 predicted 1537
7 SASI_Hs01_00079126 predicted 1523
8 SASI_Hs01_00079127 predicted 1470
9 SASI_Hs01_00079128 predicted 1612
10 SASI_Hs01_00079129 predicted 1402
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00089276 predicted 1062
2 SASI_Rn01_00089277 predicted 1138
3 SASI_Rn01_00089279 predicted 260
4 SASI_Rn01_00089280 predicted 2333
5 SASI_Rn02_00203833 predicted 2278
6 SASI_Rn01_00089281 predicted 986
7 SASI_Rn01_00089282 predicted 490
8 SASI_Rn01_00089283 predicted 411
9 SASI_Rn01_00089284 predicted 632
10 SASI_Rn01_00089285 predicted 444
11 SASI_Rn01_00089278 predicted 662
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118816 predicted 1062
2 SASI_Rn01_00118817 predicted 1132
3 SASI_Rn01_00118819 predicted 254
4 SASI_Rn01_00118820 predicted 1935
5 SASI_Rn02_00268405 predicted 1878
6 SASI_Rn01_00118821 predicted 986
7 SASI_Rn01_00118822 predicted 482
8 SASI_Rn01_00118823 predicted 411
9 SASI_Rn01_00118824 predicted 628
10 SASI_Rn01_00118825 predicted 445
11 SASI_Rn01_00118818 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101596 predicted 1046
2 SASI_Mm01_00101597 predicted 718
3 SASI_Mm01_00101598 predicted 1192
4 SASI_Mm01_00101599 predicted 2038
5 SASI_Mm01_00101601 predicted 312
6 SASI_Mm01_00101602 predicted 538
7 SASI_Mm01_00101603 predicted 845
8 SASI_Mm01_00101604 predicted 1241
9 SASI_Mm01_00101605 predicted 1147
10 SASI_Mm02_00286808 predicted 1803
11 SASI_Mm01_00101600 predicted 1245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128318 predicted 1046
2 SASI_Mm01_00128319 predicted 724
3 SASI_Mm01_00128320 predicted 1190
4 SASI_Mm01_00128321 predicted 2432
5 SASI_Mm01_00128323 predicted 317
6 SASI_Mm01_00128324 predicted 537
7 SASI_Mm01_00128325 predicted 849
8 SASI_Mm01_00128326 predicted 1242
9 SASI_Mm01_00128327 predicted 1143
10 SASI_Mm02_00335168 predicted 2189
11 SASI_Mm01_00128322 predicted 1243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024824
VALIDATED
ZC3H14 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.4-2271s21c1
Sequence:CCGGCCGTTACTTCCCTGCTTGTAACTCGAGTTACAAGCAGGGAAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.3-688s21c1
Sequence:CCGGCCAGATGATCTCATTGACGAACTCGAGTTCGTCAATGAGATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.3-345s21c1
Sequence:CCGGCGTATGGCTTCATGGTGTATTCTCGAGAATACACCATGAAGCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.4-1605s21c1
Sequence:CCGGCCATGCAGACACAAGATCATTCTCGAGAATGATCTTGTGTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-1484s1c1
Sequence:CCGGCCATGCAGACACAAGATCATTCTCGAGAATGATCTTGTGTCTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-2150s1c1
Sequence:CCGGCCGTTACTTCCCTGCTTGTAACTCGAGTTACAAGCAGGGAAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-293s1c1
Sequence:CCGGCGTATGGCTTCATGGTGTATTCTCGAGAATACACCATGAAGCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024824.2-636s1c1
Sequence:CCGGCCAGATGATCTCATTGACGAACTCGAGTTCGTCAATGAGATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024824.2-1689s1c1
Sequence:CCGGCCAGGATACATGTCAGATCAACTCGAGTTGATCTGACATGTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024824
VALIDATED
ZC3H14 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.4-2271s21c1
Sequence:CCGGCCGTTACTTCCCTGCTTGTAACTCGAGTTACAAGCAGGGAAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.3-688s21c1
Sequence:CCGGCCAGATGATCTCATTGACGAACTCGAGTTCGTCAATGAGATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.3-345s21c1
Sequence:CCGGCGTATGGCTTCATGGTGTATTCTCGAGAATACACCATGAAGCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.4-1605s21c1
Sequence:CCGGCCATGCAGACACAAGATCATTCTCGAGAATGATCTTGTGTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-1484s1c1
Sequence:CCGGCCATGCAGACACAAGATCATTCTCGAGAATGATCTTGTGTCTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-2150s1c1
Sequence:CCGGCCGTTACTTCCCTGCTTGTAACTCGAGTTACAAGCAGGGAAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-293s1c1
Sequence:CCGGCGTATGGCTTCATGGTGTATTCTCGAGAATACACCATGAAGCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024824.2-636s1c1
Sequence:CCGGCCAGATGATCTCATTGACGAACTCGAGTTCGTCAATGAGATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024824.2-1689s1c1
Sequence:CCGGCCAGGATACATGTCAGATCAACTCGAGTTGATCTGACATGTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024824
VALIDATED
ZC3H14 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.4-2271s21c1
Sequence:CCGGCCGTTACTTCCCTGCTTGTAACTCGAGTTACAAGCAGGGAAGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279787    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.3-688s21c1
Sequence:CCGGCCAGATGATCTCATTGACGAACTCGAGTTCGTCAATGAGATCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.3-345s21c1
Sequence:CCGGCGTATGGCTTCATGGTGTATTCTCGAGAATACACCATGAAGCCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024824.4-1605s21c1
Sequence:CCGGCCATGCAGACACAAGATCATTCTCGAGAATGATCTTGTGTCTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-1484s1c1
Sequence:CCGGCCATGCAGACACAAGATCATTCTCGAGAATGATCTTGTGTCTGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-2150s1c1
Sequence:CCGGCCGTTACTTCCCTGCTTGTAACTCGAGTTACAAGCAGGGAAGTAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024824.2-293s1c1
Sequence:CCGGCGTATGGCTTCATGGTGTATTCTCGAGAATACACCATGAAGCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024824.2-636s1c1
Sequence:CCGGCCAGATGATCTCATTGACGAACTCGAGTTCGTCAATGAGATCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024824.2-1689s1c1
Sequence:CCGGCCAGGATACATGTCAGATCAACTCGAGTTGATCTGACATGTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029334
VALIDATED
ZC3H14 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 14
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-656s1c1
Sequence:CCGGCTCTGAAGATGTGATTGATATCTCGAGATATCAATCACATCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-1200s1c1
Sequence:CCGGCAAGCTAACAAGAATCTAATTCTCGAGAATTAGATTCTTGTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-345s21c1
Sequence:CCGGGTATGGCTCCATGGTGTATTACTCGAGTAATACACCATGGAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-1653s21c1
Sequence:CCGGCACCTTATGCAGACACGAGATCTCGAGATCTCGTGTCTGCATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-386s21c1
Sequence:CCGGGACTGAGCCCTCTAGTCTAAACTCGAGTTTAGACTAGAGGGCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029334.2-1497s21c1
Sequence:CCGGGAGATGAGTCAAGATTACTATCTCGAGATAGTAATCTTGACTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1461s1c1
Sequence:CCGGCGACTGCAAATTGATCCAGTACTCGAGTACTGGATCAATTTGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1653s1c1
Sequence:CCGGCACCTTATGCAGACACGAGATCTCGAGATCTCGTGTCTGCATAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1497s1c1
Sequence:CCGGGAGATGAGTCAAGATTACTATCTCGAGATAGTAATCTTGACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-955s1c1
Sequence:CCGGGCAGCGTAGAAGACACTTATACTCGAGTATAAGTGTCTTCTACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029334.1-3323s1c1
Sequence:CCGGGCCTACTGTACTATGGAGTTTCTCGAGAAACTCCATAGTACAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-440s1c1
Sequence:CCGGGCCTTCAAACAAGAGCAGTTTCTCGAGAAACTGCTCTTGTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029334.1-3270s1c1
Sequence:CCGGCAGAACTATATTGCAGAGATACTCGAGTATCTCTGCAATATAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029334
VALIDATED
ZC3H14 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 14
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-656s1c1
Sequence:CCGGCTCTGAAGATGTGATTGATATCTCGAGATATCAATCACATCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-1200s1c1
Sequence:CCGGCAAGCTAACAAGAATCTAATTCTCGAGAATTAGATTCTTGTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-345s21c1
Sequence:CCGGGTATGGCTCCATGGTGTATTACTCGAGTAATACACCATGGAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-1653s21c1
Sequence:CCGGCACCTTATGCAGACACGAGATCTCGAGATCTCGTGTCTGCATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-386s21c1
Sequence:CCGGGACTGAGCCCTCTAGTCTAAACTCGAGTTTAGACTAGAGGGCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029334.2-1497s21c1
Sequence:CCGGGAGATGAGTCAAGATTACTATCTCGAGATAGTAATCTTGACTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1461s1c1
Sequence:CCGGCGACTGCAAATTGATCCAGTACTCGAGTACTGGATCAATTTGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1653s1c1
Sequence:CCGGCACCTTATGCAGACACGAGATCTCGAGATCTCGTGTCTGCATAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1497s1c1
Sequence:CCGGGAGATGAGTCAAGATTACTATCTCGAGATAGTAATCTTGACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-955s1c1
Sequence:CCGGGCAGCGTAGAAGACACTTATACTCGAGTATAAGTGTCTTCTACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029334.1-3323s1c1
Sequence:CCGGGCCTACTGTACTATGGAGTTTCTCGAGAAACTCCATAGTACAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-440s1c1
Sequence:CCGGGCCTTCAAACAAGAGCAGTTTCTCGAGAAACTGCTCTTGTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029334.1-3270s1c1
Sequence:CCGGCAGAACTATATTGCAGAGATACTCGAGTATCTCTGCAATATAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029334
VALIDATED
ZC3H14 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 14
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-656s1c1
Sequence:CCGGCTCTGAAGATGTGATTGATATCTCGAGATATCAATCACATCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216150    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-1200s1c1
Sequence:CCGGCAAGCTAACAAGAATCTAATTCTCGAGAATTAGATTCTTGTTAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-345s21c1
Sequence:CCGGGTATGGCTCCATGGTGTATTACTCGAGTAATACACCATGGAGCCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-1653s21c1
Sequence:CCGGCACCTTATGCAGACACGAGATCTCGAGATCTCGTGTCTGCATAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029334.2-386s21c1
Sequence:CCGGGACTGAGCCCTCTAGTCTAAACTCGAGTTTAGACTAGAGGGCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029334.2-1497s21c1
Sequence:CCGGGAGATGAGTCAAGATTACTATCTCGAGATAGTAATCTTGACTCATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1461s1c1
Sequence:CCGGCGACTGCAAATTGATCCAGTACTCGAGTACTGGATCAATTTGCAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1653s1c1
Sequence:CCGGCACCTTATGCAGACACGAGATCTCGAGATCTCGTGTCTGCATAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029334.1-1497s1c1
Sequence:CCGGGAGATGAGTCAAGATTACTATCTCGAGATAGTAATCTTGACTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-955s1c1
Sequence:CCGGGCAGCGTAGAAGACACTTATACTCGAGTATAAGTGTCTTCTACGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029334.1-3323s1c1
Sequence:CCGGGCCTACTGTACTATGGAGTTTCTCGAGAAACTCCATAGTACAGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029334.1-440s1c1
Sequence:CCGGGCCTTCAAACAAGAGCAGTTTCTCGAGAAACTGCTCTTGTTTGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029334.1-3270s1c1
Sequence:CCGGCAGAACTATATTGCAGAGATACTCGAGTATCTCTGCAATATAGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks