EMAIL THIS PAGE TO A FRIEND

ZC3H15

zinc finger CCCH-type containing 15

Synonyms: HT010 LEREPO4 MSTP012
Gene ID:
Mouse(69082) zinc finger CCCH-type containing 15
Rat(362154) zinc finger CCCH-type containing 15
Zebrafish(334307) zinc finger CCCH-type containing 15
chicken(423992) zinc finger CCCH-type containing 15
dog(478831) zinc finger CCCH-type containing 15
domestic cat(101085563) zinc finger CCCH-type containing 15
naked mole-rat(101712393) zinc finger CCCH-type containing 15
domestic guinea pig(100718070) zinc finger CCCH-type containing 15
cow(787773) erythropoietin 4 immediate early response-like
cow(535102) zinc finger CCCH-type containing 15
sheep(101116282) zinc finger CCCH-type containing 15
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026934 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026934 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026934 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018471 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018471 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018471 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018471 Rosetta Predictions human pricing
NM_001010963 Rosetta Predictions rat pricing
NM_026934 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018471 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352037 predicted 1545
2 SASI_Hs01_00033059 predicted 454
3 SASI_Hs02_00352038 predicted 1504
4 SASI_Hs01_00033063 predicted 1581
5 SASI_Hs01_00033064 predicted 1205
6 SASI_Hs01_00033066 predicted 282
7 SASI_Hs01_00033067 predicted 1286
8 SASI_Hs01_00033068 predicted 1240
9 SASI_Hs02_00352039 predicted 1412
10 SASI_Hs02_00352040 predicted 1272
11 SASI_Hs01_00033060 predicted 1698
12 SASI_Hs01_00033061 predicted 1482
13 SASI_Hs01_00033062 predicted 1319
14 SASI_Hs01_00033065 predicted 1657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010963 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042947 predicted 1361
2 SASI_Rn01_00042948 predicted 273
3 SASI_Rn01_00042949 predicted 1401
4 SASI_Rn01_00042950 predicted 1017
5 SASI_Rn01_00042951 predicted 1367
6 SASI_Rn01_00042952 predicted 1355
7 SASI_Rn01_00042953 predicted 1294
8 SASI_Rn01_00042954 predicted 1222
9 SASI_Rn01_00042955 predicted 1047
10 SASI_Rn02_00199836 predicted 1130
11 SASI_Rn01_00042956 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026934 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128248 predicted 1057
2 SASI_Mm01_00128249 predicted 1385
3 SASI_Mm01_00128250 predicted 1401
4 SASI_Mm01_00128251 predicted 1389
5 SASI_Mm01_00128252 predicted 1383
6 SASI_Mm02_00331227 predicted 223
7 SASI_Mm01_00128253 predicted 1417
8 SASI_Mm01_00128254 predicted 1210
9 SASI_Mm01_00128255 predicted 1255
10 SASI_Mm02_00331228 predicted 1137
11 SASI_Mm01_00128256 predicted 1139
12 SASI_Mm01_00128257 predicted 311
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026934
ZC3H15 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 15
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-1000s1c1
Sequence:CCGGGCAGACGATACCCGTTACATTCTCGAGAATGTAACGGGTATCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026934.2-1377s1c1
Sequence:CCGGGCTCACTAGGATCAACATGAACTCGAGTTCATGTTGATCCTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-208s1c1
Sequence:CCGGGCTGTCACTCATCAAGTGAAACTCGAGTTTCACTTGATGAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-493s1c1
Sequence:CCGGGCAAGAGATGAAGAACTTGAACTCGAGTTCAAGTTCTTCATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-493s21c1
Sequence:CCGGGCAAGAGATGAAGAACTTGAACTCGAGTTCAAGTTCTTCATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-208s21c1
Sequence:CCGGGCTGTCACTCATCAAGTGAAACTCGAGTTTCACTTGATGAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-1000s21c1
Sequence:CCGGGCAGACGATACCCGTTACATTCTCGAGAATGTAACGGGTATCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026934.3-1377s21c1
Sequence:CCGGGCTCACTAGGATCAACATGAACTCGAGTTCATGTTGATCCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026934
ZC3H15 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 15
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-1000s1c1
Sequence:CCGGGCAGACGATACCCGTTACATTCTCGAGAATGTAACGGGTATCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026934.2-1377s1c1
Sequence:CCGGGCTCACTAGGATCAACATGAACTCGAGTTCATGTTGATCCTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-208s1c1
Sequence:CCGGGCTGTCACTCATCAAGTGAAACTCGAGTTTCACTTGATGAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-493s1c1
Sequence:CCGGGCAAGAGATGAAGAACTTGAACTCGAGTTCAAGTTCTTCATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-493s21c1
Sequence:CCGGGCAAGAGATGAAGAACTTGAACTCGAGTTCAAGTTCTTCATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-208s21c1
Sequence:CCGGGCTGTCACTCATCAAGTGAAACTCGAGTTTCACTTGATGAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-1000s21c1
Sequence:CCGGGCAGACGATACCCGTTACATTCTCGAGAATGTAACGGGTATCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026934.3-1377s21c1
Sequence:CCGGGCTCACTAGGATCAACATGAACTCGAGTTCATGTTGATCCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026934
ZC3H15 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 15
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-1000s1c1
Sequence:CCGGGCAGACGATACCCGTTACATTCTCGAGAATGTAACGGGTATCGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176167    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026934.2-1377s1c1
Sequence:CCGGGCTCACTAGGATCAACATGAACTCGAGTTCATGTTGATCCTAGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-208s1c1
Sequence:CCGGGCTGTCACTCATCAAGTGAAACTCGAGTTTCACTTGATGAGTGACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026934.2-493s1c1
Sequence:CCGGGCAAGAGATGAAGAACTTGAACTCGAGTTCAAGTTCTTCATCTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-493s21c1
Sequence:CCGGGCAAGAGATGAAGAACTTGAACTCGAGTTCAAGTTCTTCATCTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-208s21c1
Sequence:CCGGGCTGTCACTCATCAAGTGAAACTCGAGTTTCACTTGATGAGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026934.3-1000s21c1
Sequence:CCGGGCAGACGATACCCGTTACATTCTCGAGAATGTAACGGGTATCGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314308    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026934.3-1377s21c1
Sequence:CCGGGCTCACTAGGATCAACATGAACTCGAGTTCATGTTGATCCTAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018471
VALIDATED
ZC3H15 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 15
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-1061s1c1
Sequence:CCGGGCTGACTTCAAAGCAGGGAAACTCGAGTTTCCCTGCTTTGAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-1578s1c1
Sequence:CCGGCCTAGAATCAACAGGATGTTTCTCGAGAAACATCCTGTTGATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018471.1-1773s1c1
Sequence:CCGGGAAGTGTATCTGCCTTTCCATCTCGAGATGGAAAGGCAGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-519s1c1
Sequence:CCGGCAGATCCCAAGTCTGTAGTATCTCGAGATACTACAGACTTGGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018471.1-765s1c1
Sequence:CCGGGCAAGCATTTCCTGGAAGCTACTCGAGTAGCTTCCAGGAAATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-473s1c1
Sequence:CCGGGAGCTGTTCAAACCTGTAGTTCTCGAGAACTACAGGTTTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-518s21c1
Sequence:CCGGCAGATCCCAAGTCTGTAGTATCTCGAGATACTACAGACTTGGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018471.2-1776s21c1
Sequence:CCGGGAAGTGTATCTGCCTTTCCATCTCGAGATGGAAAGGCAGATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-1060s21c1
Sequence:CCGGGCTGACTTCAAAGCAGGGAAACTCGAGTTTCCCTGCTTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-472s21c1
Sequence:CCGGGAGCTGTTCAAACCTGTAGTTCTCGAGAACTACAGGTTTGAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018471.2-1579s21c1
Sequence:CCGGCCTAGAATCAACAGGATGTTTCTCGAGAAACATCCTGTTGATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018471
VALIDATED
ZC3H15 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 15
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-1061s1c1
Sequence:CCGGGCTGACTTCAAAGCAGGGAAACTCGAGTTTCCCTGCTTTGAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-1578s1c1
Sequence:CCGGCCTAGAATCAACAGGATGTTTCTCGAGAAACATCCTGTTGATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018471.1-1773s1c1
Sequence:CCGGGAAGTGTATCTGCCTTTCCATCTCGAGATGGAAAGGCAGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-519s1c1
Sequence:CCGGCAGATCCCAAGTCTGTAGTATCTCGAGATACTACAGACTTGGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018471.1-765s1c1
Sequence:CCGGGCAAGCATTTCCTGGAAGCTACTCGAGTAGCTTCCAGGAAATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-473s1c1
Sequence:CCGGGAGCTGTTCAAACCTGTAGTTCTCGAGAACTACAGGTTTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-518s21c1
Sequence:CCGGCAGATCCCAAGTCTGTAGTATCTCGAGATACTACAGACTTGGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018471.2-1776s21c1
Sequence:CCGGGAAGTGTATCTGCCTTTCCATCTCGAGATGGAAAGGCAGATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-1060s21c1
Sequence:CCGGGCTGACTTCAAAGCAGGGAAACTCGAGTTTCCCTGCTTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-472s21c1
Sequence:CCGGGAGCTGTTCAAACCTGTAGTTCTCGAGAACTACAGGTTTGAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018471.2-1579s21c1
Sequence:CCGGCCTAGAATCAACAGGATGTTTCTCGAGAAACATCCTGTTGATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018471
VALIDATED
ZC3H15 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 15
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-1061s1c1
Sequence:CCGGGCTGACTTCAAAGCAGGGAAACTCGAGTTTCCCTGCTTTGAAGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134190    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-1578s1c1
Sequence:CCGGCCTAGAATCAACAGGATGTTTCTCGAGAAACATCCTGTTGATTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137309    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018471.1-1773s1c1
Sequence:CCGGGAAGTGTATCTGCCTTTCCATCTCGAGATGGAAAGGCAGATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-519s1c1
Sequence:CCGGCAGATCCCAAGTCTGTAGTATCTCGAGATACTACAGACTTGGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137781    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018471.1-765s1c1
Sequence:CCGGGCAAGCATTTCCTGGAAGCTACTCGAGTAGCTTCCAGGAAATGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018471.1-473s1c1
Sequence:CCGGGAGCTGTTCAAACCTGTAGTTCTCGAGAACTACAGGTTTGAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-518s21c1
Sequence:CCGGCAGATCCCAAGTCTGTAGTATCTCGAGATACTACAGACTTGGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018471.2-1776s21c1
Sequence:CCGGGAAGTGTATCTGCCTTTCCATCTCGAGATGGAAAGGCAGATACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278342    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-1060s21c1
Sequence:CCGGGCTGACTTCAAAGCAGGGAAACTCGAGTTTCCCTGCTTTGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018471.2-472s21c1
Sequence:CCGGGAGCTGTTCAAACCTGTAGTTCTCGAGAACTACAGGTTTGAACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018471.2-1579s21c1
Sequence:CCGGCCTAGAATCAACAGGATGTTTCTCGAGAAACATCCTGTTGATTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks