EMAIL THIS PAGE TO A FRIEND

ZC3H18

zinc finger CCCH-type containing 18

Synonyms: NHN1
UniProtKB ID: Q86VM9, Q96DG4, Q96MP7
Gene ID:
Mouse(76014) zinc finger CCCH-type containing 18
Rat(292067) zinc finger CCCH-type containing 18
cow(523958) zinc finger CCCH-type containing 18
sheep(101106788) zinc finger CCCH-type containing 18
domestic guinea pig(100732327) zinc finger CCCH-type containing 18
naked mole-rat(101717392) zinc finger CCCH-type containing 18
Zebrafish(555770) zinc finger CCCH-type containing 18
domestic cat(101097196) zinc finger CCCH-type containing 18
dog(489665) zinc finger CCCH-type containing 18
chicken(415838) zinc finger CCCH-type containing 18
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001029993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001029993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144604 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144604 Rosetta Predictions human pricing
NM_201416 Rosetta Predictions rat pricing
NM_001029993 Rosetta Predictions mouse pricing
NM_001029994 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090419 predicted 2631
2 SASI_Hs01_00090420 predicted 275
3 SASI_Hs01_00090421 predicted 1793
4 SASI_Hs01_00090422 predicted 1897
5 SASI_Hs01_00090423 predicted 813
6 SASI_Hs01_00090424 predicted 2475
7 SASI_Hs01_00090425 predicted 850
8 SASI_Hs01_00090426 predicted 2601
9 SASI_Hs01_00090428 predicted 469
10 SASI_Hs02_00364407 predicted 956
11 SASI_Hs01_00090427 predicted 2572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047719 predicted 1208
2 SASI_Rn01_00047720 predicted 1038
3 SASI_Rn01_00047721 predicted 1150
4 SASI_Rn02_00270309 predicted 2234
5 SASI_Rn01_00047722 predicted 1161
6 SASI_Rn01_00047723 predicted 672
7 SASI_Rn01_00047724 predicted 2489
8 SASI_Rn01_00047725 predicted 1242
9 SASI_Rn01_00047726 predicted 2549
10 SASI_Rn02_00270310 predicted 307
11 SASI_Rn01_00047718 predicted 2340
12 SASI_Rn01_00047727 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288100 predicted 1347
2 SASI_Mm02_00288101 predicted 263
3 SASI_Mm02_00288102 predicted 1241
4 SASI_Mm02_00288103 predicted 1335
5 SASI_Mm02_00288104 predicted 2682
6 SASI_Mm02_00288105 predicted 2718
7 SASI_Mm02_00288106 predicted 2935
8 SASI_Mm02_00288107 predicted 2722
9 SASI_Mm02_00288108 predicted 2985
10 SASI_Mm02_00288109 predicted 2231
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288110 predicted 1279
2 SASI_Mm02_00288111 predicted 262
3 SASI_Mm02_00288112 predicted 1171
4 SASI_Mm02_00288113 predicted 1267
5 SASI_Mm02_00288114 predicted 2611
6 SASI_Mm02_00288115 predicted 2641
7 SASI_Mm02_00288116 predicted 2860
8 SASI_Mm02_00288117 predicted 2655
9 SASI_Mm02_00288118 predicted 2907
10 SASI_Mm02_00288119 predicted 2158
11 SASI_Mm01_00067404 predicted 864
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029993
VALIDATED
ZC3H18 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-768s21c1
Sequence:CCGGAGATCGATGATGGCGAGATAGCTCGAGCTATCTCGCCATCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-961s21c1
Sequence:CCGGGGGAATGAGCTGTAGGTTTATCTCGAGATAAACCTACAGCTCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-1376s21c1
Sequence:CCGGGACTATGAGATAGAACGGTTTCTCGAGAAACCGTTCTATCTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-558s21c1
Sequence:CCGGATGAGCATGAACTAGACTATGCTCGAGCATAGTCTAGTTCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029993.1-3551s21c1
Sequence:CCGGTCCCTGGATCAGAAGTATATACTCGAGTATATACTTCTGATCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029993.1-3609s1c1
Sequence:CCGGGCCTAAAGTCTGATTGGGAAACTCGAGTTTCCCAATCAGACTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-1376s1c1
Sequence:CCGGGACTATGAGATAGAACGGTTTCTCGAGAAACCGTTCTATCTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-936s1c1
Sequence:CCGGGCCAGGTTAAAGGAAACTGCACTCGAGTGCAGTTTCCTTTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-3050s1c1
Sequence:CCGGCTTAAACAGCTCAAAGCGGTTCTCGAGAACCGCTTTGAGCTGTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-870s1c1
Sequence:CCGGTGAAAGATGTTGTGACACCATCTCGAGATGGTGTCACAACATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029993
VALIDATED
ZC3H18 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-768s21c1
Sequence:CCGGAGATCGATGATGGCGAGATAGCTCGAGCTATCTCGCCATCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-961s21c1
Sequence:CCGGGGGAATGAGCTGTAGGTTTATCTCGAGATAAACCTACAGCTCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-1376s21c1
Sequence:CCGGGACTATGAGATAGAACGGTTTCTCGAGAAACCGTTCTATCTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-558s21c1
Sequence:CCGGATGAGCATGAACTAGACTATGCTCGAGCATAGTCTAGTTCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029993.1-3551s21c1
Sequence:CCGGTCCCTGGATCAGAAGTATATACTCGAGTATATACTTCTGATCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029993.1-3609s1c1
Sequence:CCGGGCCTAAAGTCTGATTGGGAAACTCGAGTTTCCCAATCAGACTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-1376s1c1
Sequence:CCGGGACTATGAGATAGAACGGTTTCTCGAGAAACCGTTCTATCTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-936s1c1
Sequence:CCGGGCCAGGTTAAAGGAAACTGCACTCGAGTGCAGTTTCCTTTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-3050s1c1
Sequence:CCGGCTTAAACAGCTCAAAGCGGTTCTCGAGAACCGCTTTGAGCTGTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-870s1c1
Sequence:CCGGTGAAAGATGTTGTGACACCATCTCGAGATGGTGTCACAACATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029993
VALIDATED
ZC3H18 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307481    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-768s21c1
Sequence:CCGGAGATCGATGATGGCGAGATAGCTCGAGCTATCTCGCCATCATCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-961s21c1
Sequence:CCGGGGGAATGAGCTGTAGGTTTATCTCGAGATAAACCTACAGCTCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-1376s21c1
Sequence:CCGGGACTATGAGATAGAACGGTTTCTCGAGAAACCGTTCTATCTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029993.1-558s21c1
Sequence:CCGGATGAGCATGAACTAGACTATGCTCGAGCATAGTCTAGTTCATGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001029993.1-3551s21c1
Sequence:CCGGTCCCTGGATCAGAAGTATATACTCGAGTATATACTTCTGATCCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123494    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001029993.1-3609s1c1
Sequence:CCGGGCCTAAAGTCTGATTGGGAAACTCGAGTTTCCCAATCAGACTTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-1376s1c1
Sequence:CCGGGACTATGAGATAGAACGGTTTCTCGAGAAACCGTTCTATCTCATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-936s1c1
Sequence:CCGGGCCAGGTTAAAGGAAACTGCACTCGAGTGCAGTTTCCTTTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-3050s1c1
Sequence:CCGGCTTAAACAGCTCAAAGCGGTTCTCGAGAACCGCTTTGAGCTGTTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029993.1-870s1c1
Sequence:CCGGTGAAAGATGTTGTGACACCATCTCGAGATGGTGTCACAACATCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144604
VALIDATED
ZC3H18 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1788s21c1
Sequence:CCGGGTCAGCCTCTGCCTCTAATTCCTCGAGGAATTAGAGGCAGAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1243s21c1
Sequence:CCGGCCTTACGCAGACCCTTATTATCTCGAGATAATAAGGGTCTGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1150s21c1
Sequence:CCGGGGCGAAGACGAACGGGAATTTCTCGAGAAATTCCCGTTCGTCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-849s21c1
Sequence:CCGGGGGAATGAATTGTAGGTTTATCTCGAGATAAACCTACAATTCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-3243s1c1
Sequence:CCGGCCAGCACGGTTCTCATGTAAACTCGAGTTTACATGAGAACCGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-1248s1c1
Sequence:CCGGCGCAGACCCTTATTATGACTACTCGAGTAGTCATAATAAGGGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-2605s1c1
Sequence:CCGGCTGTTGAATAAGGCGGCTGATCTCGAGATCAGCCGCCTTATTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144604.2-1337s1c1
Sequence:CCGGCGTATCATAATTACCGAGAAACTCGAGTTTCTCGGTAATTATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-2607s1c1
Sequence:CCGGGTTGAATAAGGCGGCTGATAACTCGAGTTATCAGCCGCCTTATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144604
VALIDATED
ZC3H18 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1788s21c1
Sequence:CCGGGTCAGCCTCTGCCTCTAATTCCTCGAGGAATTAGAGGCAGAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1243s21c1
Sequence:CCGGCCTTACGCAGACCCTTATTATCTCGAGATAATAAGGGTCTGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1150s21c1
Sequence:CCGGGGCGAAGACGAACGGGAATTTCTCGAGAAATTCCCGTTCGTCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-849s21c1
Sequence:CCGGGGGAATGAATTGTAGGTTTATCTCGAGATAAACCTACAATTCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-3243s1c1
Sequence:CCGGCCAGCACGGTTCTCATGTAAACTCGAGTTTACATGAGAACCGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-1248s1c1
Sequence:CCGGCGCAGACCCTTATTATGACTACTCGAGTAGTCATAATAAGGGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-2605s1c1
Sequence:CCGGCTGTTGAATAAGGCGGCTGATCTCGAGATCAGCCGCCTTATTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144604.2-1337s1c1
Sequence:CCGGCGTATCATAATTACCGAGAAACTCGAGTTTCTCGGTAATTATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-2607s1c1
Sequence:CCGGGTTGAATAAGGCGGCTGATAACTCGAGTTATCAGCCGCCTTATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144604
VALIDATED
ZC3H18 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1788s21c1
Sequence:CCGGGTCAGCCTCTGCCTCTAATTCCTCGAGGAATTAGAGGCAGAGGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1243s21c1
Sequence:CCGGCCTTACGCAGACCCTTATTATCTCGAGATAATAAGGGTCTGCGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-1150s21c1
Sequence:CCGGGGCGAAGACGAACGGGAATTTCTCGAGAAATTCCCGTTCGTCTTCGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_144604.2-849s21c1
Sequence:CCGGGGGAATGAATTGTAGGTTTATCTCGAGATAAACCTACAATTCATTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075168    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-3243s1c1
Sequence:CCGGCCAGCACGGTTCTCATGTAAACTCGAGTTTACATGAGAACCGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-1248s1c1
Sequence:CCGGCGCAGACCCTTATTATGACTACTCGAGTAGTCATAATAAGGGTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-2605s1c1
Sequence:CCGGCTGTTGAATAAGGCGGCTGATCTCGAGATCAGCCGCCTTATTCAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144604.2-1337s1c1
Sequence:CCGGCGTATCATAATTACCGAGAAACTCGAGTTTCTCGGTAATTATGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_144604.2-2607s1c1
Sequence:CCGGGTTGAATAAGGCGGCTGATAACTCGAGTTATCAGCCGCCTTATTCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks