EMAIL THIS PAGE TO A FRIEND

ZC3H3

zinc finger CCCH-type containing 3

Synonyms: ZC3HDC3
UniProtKB ID: Q8IXZ2, Q14163, Q8N4E2, Q9BUS4
Gene ID:
Mouse(223642) zinc finger CCCH type containing 3
Rat(300032) zinc finger CCCH type containing 3
fruit fly(38968) CG6694 gene product from transcript CG6694-RA
Horse(100065889) zinc finger CCCH-type containing 3
domestic cat(101089241) zinc finger CCCH-type containing 3
dog(482077) zinc finger CCCH-type containing 3
chicken(430349) zinc finger CCCH-type containing 3
Zebrafish(561182) zinc finger CCCH-type containing 3
naked mole-rat(101724950) zinc finger CCCH-type containing 3
domestic guinea pig(100733191) zinc finger CCCH-type containing 3
cow(515615) zinc finger CCCH-type containing 3
sheep(101114029) zinc finger CCCH-type containing 3
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015117 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015117 Rosetta Predictions human pricing
NM_001134865 Rosetta Predictions rat pricing
XM_001074381 Rosetta Predictions rat pricing
NM_172121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00164434 predicted 1380
2 SASI_Hs01_00164435 predicted 914
3 SASI_Hs01_00164436 predicted 606
4 SASI_Hs01_00164439 predicted 570
5 SASI_Hs01_00164440 predicted 930
6 SASI_Hs01_00164443 predicted 2034
7 SASI_Hs02_00347016 predicted 340
8 SASI_Hs02_00347017 predicted 2263
9 SASI_Hs02_00347018 predicted 2244
10 SASI_Hs02_00347019 predicted 380
11 SASI_Hs01_00164437 predicted 1056
12 SASI_Hs01_00164438 predicted 2198
13 SASI_Hs01_00164441 predicted 1849
14 SASI_Hs01_00164442 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258854 predicted 635
2 SASI_Rn02_00258855 predicted 2041
3 SASI_Rn02_00258856 predicted 250
4 SASI_Rn02_00258857 predicted 631
5 SASI_Rn02_00258858 predicted 819
6 SASI_Rn02_00258859 predicted 1731
7 SASI_Rn02_00258860 predicted 262
8 SASI_Rn02_00258861 predicted 555
9 SASI_Rn02_00258862 predicted 422
10 SASI_Rn02_00258863 predicted 2034
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345990 predicted 634
2 SASI_Rn02_00345991 predicted 2052
3 SASI_Rn02_00345992 predicted 245
4 SASI_Rn02_00345993 predicted 633
5 SASI_Rn02_00345994 predicted 817
6 SASI_Rn02_00345995 predicted 1735
7 SASI_Rn02_00345996 predicted 257
8 SASI_Rn02_00345997 predicted 564
9 SASI_Rn02_00345998 predicted 426
10 SASI_Rn02_00345999 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131030 predicted 224
2 SASI_Mm01_00131032 predicted 364
3 SASI_Mm01_00131033 predicted 534
4 SASI_Mm02_00343659 predicted 1321
5 SASI_Mm01_00131034 predicted 2583
6 SASI_Mm01_00131035 predicted 2004
7 SASI_Mm01_00131036 predicted 746
8 SASI_Mm01_00131037 predicted 935
9 SASI_Mm01_00131038 predicted 2006
10 SASI_Mm02_00343660 predicted 2843
11 SASI_Mm01_00131031 predicted 247
12 SASI_Mm01_00131039 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172121
VALIDATED
ZC3H3 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1617s1c1
Sequence:CCGGGCTACCGCATTGTTAAGAAGACTCGAGTCTTCTTAACAATGCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-1984s1c1
Sequence:CCGGGAAGCAGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1128s1c1
Sequence:CCGGGCAAGTACAAGTGGAAGGCTTCTCGAGAAGCCTTCCACTTGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-226s1c1
Sequence:CCGGCAAGAAATACTCCCTTGTGAACTCGAGTTCACAAGGGAGTATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172121.1-766s1c1
Sequence:CCGGCAGCTATTCTGAACAGTTCATCTCGAGATGAACTGTTCAGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1309s1c1
Sequence:CCGGGCTCTCAGCTTACAAAGTGAACTCGAGTTCACTTTGTAAGCTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-55s1c1
Sequence:CCGGGCAGGGTCTAATTGATGACTACTCGAGTAGTCATCAATTAGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-369s1c1
Sequence:CCGGCAGATCAGAATATGGTTATTACTCGAGTAATAACCATATTCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172121
VALIDATED
ZC3H3 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1617s1c1
Sequence:CCGGGCTACCGCATTGTTAAGAAGACTCGAGTCTTCTTAACAATGCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-1984s1c1
Sequence:CCGGGAAGCAGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1128s1c1
Sequence:CCGGGCAAGTACAAGTGGAAGGCTTCTCGAGAAGCCTTCCACTTGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-226s1c1
Sequence:CCGGCAAGAAATACTCCCTTGTGAACTCGAGTTCACAAGGGAGTATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172121.1-766s1c1
Sequence:CCGGCAGCTATTCTGAACAGTTCATCTCGAGATGAACTGTTCAGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1309s1c1
Sequence:CCGGGCTCTCAGCTTACAAAGTGAACTCGAGTTCACTTTGTAAGCTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-55s1c1
Sequence:CCGGGCAGGGTCTAATTGATGACTACTCGAGTAGTCATCAATTAGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-369s1c1
Sequence:CCGGCAGATCAGAATATGGTTATTACTCGAGTAATAACCATATTCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172121
VALIDATED
ZC3H3 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1617s1c1
Sequence:CCGGGCTACCGCATTGTTAAGAAGACTCGAGTCTTCTTAACAATGCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-1984s1c1
Sequence:CCGGGAAGCAGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1128s1c1
Sequence:CCGGGCAAGTACAAGTGGAAGGCTTCTCGAGAAGCCTTCCACTTGTACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197567    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-226s1c1
Sequence:CCGGCAAGAAATACTCCCTTGTGAACTCGAGTTCACAAGGGAGTATTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_172121.1-766s1c1
Sequence:CCGGCAGCTATTCTGAACAGTTCATCTCGAGATGAACTGTTCAGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-1309s1c1
Sequence:CCGGGCTCTCAGCTTACAAAGTGAACTCGAGTTCACTTTGTAAGCTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172121.1-55s1c1
Sequence:CCGGGCAGGGTCTAATTGATGACTACTCGAGTAGTCATCAATTAGACCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216279    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172121.1-369s1c1
Sequence:CCGGCAGATCAGAATATGGTTATTACTCGAGTAATAACCATATTCTGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015117
VALIDATED
ZC3H3 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-1041s1c1
Sequence:CCGGCATGGCAAACAAGGTGGAGAACTCGAGTTCTCCACCTTGTTTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-2225s1c1
Sequence:CCGGGCAACAGCAACTGTCCCTATACTCGAGTATAGGGACAGTTGCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-373s1c1
Sequence:CCGGCAGAACGTGGTCATCAAAGTTCTCGAGAACTTTGATGACCACGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-2019s1c1
Sequence:CCGGGAAGGAGTACTGCATGTACTACTCGAGTAGTACATGCAGTACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015117.1-909s1c1
Sequence:CCGGGACCTGTCGAACTAACAAGTTCTCGAGAACTTGTTAGTTCGACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-1628s1c1
Sequence:CCGGGCTACCGCATTGTCAAGAAGACTCGAGTCTTCTTGACAATGCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-224s1c1
Sequence:CCGGGCAAGAAATACTCCCTCGTGACTCGAGTCACGAGGGAGTATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-2319s1c1
Sequence:CCGGGTGCAAGAAGAAACACACGCTCTCGAGAGCGTGTGTTTCTTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-244s21c1
Sequence:CCGGAGAAATACTCCCTCGTGAATCCTCGAGGATTCACGAGGGAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-75s21c1
Sequence:CCGGGGTCTGATTGATGACTACAAACTCGAGTTTGTAGTCATCAATCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-392s21c1
Sequence:CCGGGAACGTGGTCATCAAAGTTAACTCGAGTTAACTTTGATGACCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-682s21c1
Sequence:CCGGCAGTCAGTGAGAGTGTGATTGCTCGAGCAATCACACTCTCACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015117.2-2845s21c1
Sequence:CCGGGGAAGCCTCTGCACATCAAACCTCGAGGTTTGATGTGCAGAGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-2923s21c1
Sequence:CCGGAGAGGAAAGAGGCTCTGTCCACTCGAGTGGACAGAGCCTCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015117.2-2897s21c1
Sequence:CCGGCACCTACCTCAGACCCTCATCCTCGAGGATGAGGGTCTGAGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015117
VALIDATED
ZC3H3 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-1041s1c1
Sequence:CCGGCATGGCAAACAAGGTGGAGAACTCGAGTTCTCCACCTTGTTTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-2225s1c1
Sequence:CCGGGCAACAGCAACTGTCCCTATACTCGAGTATAGGGACAGTTGCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-373s1c1
Sequence:CCGGCAGAACGTGGTCATCAAAGTTCTCGAGAACTTTGATGACCACGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-2019s1c1
Sequence:CCGGGAAGGAGTACTGCATGTACTACTCGAGTAGTACATGCAGTACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015117.1-909s1c1
Sequence:CCGGGACCTGTCGAACTAACAAGTTCTCGAGAACTTGTTAGTTCGACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-1628s1c1
Sequence:CCGGGCTACCGCATTGTCAAGAAGACTCGAGTCTTCTTGACAATGCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-224s1c1
Sequence:CCGGGCAAGAAATACTCCCTCGTGACTCGAGTCACGAGGGAGTATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-2319s1c1
Sequence:CCGGGTGCAAGAAGAAACACACGCTCTCGAGAGCGTGTGTTTCTTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-244s21c1
Sequence:CCGGAGAAATACTCCCTCGTGAATCCTCGAGGATTCACGAGGGAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-75s21c1
Sequence:CCGGGGTCTGATTGATGACTACAAACTCGAGTTTGTAGTCATCAATCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-392s21c1
Sequence:CCGGGAACGTGGTCATCAAAGTTAACTCGAGTTAACTTTGATGACCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-682s21c1
Sequence:CCGGCAGTCAGTGAGAGTGTGATTGCTCGAGCAATCACACTCTCACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015117.2-2845s21c1
Sequence:CCGGGGAAGCCTCTGCACATCAAACCTCGAGGTTTGATGTGCAGAGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-2923s21c1
Sequence:CCGGAGAGGAAAGAGGCTCTGTCCACTCGAGTGGACAGAGCCTCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015117.2-2897s21c1
Sequence:CCGGCACCTACCTCAGACCCTCATCCTCGAGGATGAGGGTCTGAGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015117
VALIDATED
ZC3H3 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138517    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-1041s1c1
Sequence:CCGGCATGGCAAACAAGGTGGAGAACTCGAGTTCTCCACCTTGTTTGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-2225s1c1
Sequence:CCGGGCAACAGCAACTGTCCCTATACTCGAGTATAGGGACAGTTGCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-373s1c1
Sequence:CCGGCAGAACGTGGTCATCAAAGTTCTCGAGAACTTTGATGACCACGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135666    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-2019s1c1
Sequence:CCGGGAAGGAGTACTGCATGTACTACTCGAGTAGTACATGCAGTACTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015117.1-909s1c1
Sequence:CCGGGACCTGTCGAACTAACAAGTTCTCGAGAACTTGTTAGTTCGACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-1628s1c1
Sequence:CCGGGCTACCGCATTGTCAAGAAGACTCGAGTCTTCTTGACAATGCGGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015117.1-224s1c1
Sequence:CCGGGCAAGAAATACTCCCTCGTGACTCGAGTCACGAGGGAGTATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138111    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015117.1-2319s1c1
Sequence:CCGGGTGCAAGAAGAAACACACGCTCTCGAGAGCGTGTGTTTCTTCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-244s21c1
Sequence:CCGGAGAAATACTCCCTCGTGAATCCTCGAGGATTCACGAGGGAGTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-75s21c1
Sequence:CCGGGGTCTGATTGATGACTACAAACTCGAGTTTGTAGTCATCAATCAGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-392s21c1
Sequence:CCGGGAACGTGGTCATCAAAGTTAACTCGAGTTAACTTTGATGACCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-682s21c1
Sequence:CCGGCAGTCAGTGAGAGTGTGATTGCTCGAGCAATCACACTCTCACTGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015117.2-2845s21c1
Sequence:CCGGGGAAGCCTCTGCACATCAAACCTCGAGGTTTGATGTGCAGAGGCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370583    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_015117.2-2923s21c1
Sequence:CCGGAGAGGAAAGAGGCTCTGTCCACTCGAGTGGACAGAGCCTCTTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015117.2-2897s21c1
Sequence:CCGGCACCTACCTCAGACCCTCATCCTCGAGGATGAGGGTCTGAGGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks