EMAIL THIS PAGE TO A FRIEND

ZC3H4

zinc finger CCCH-type containing 4

Synonyms: C19orf7
UniProtKB ID: Q9UPT8, Q9Y420
Gene ID:
Human(23211) Summary: This gene encodes a member of a family of CCCH (C-x8-C-x5-C-x3-H type) zinc finger domain-containing proteins. These zinc finger domains, which coordinate zinc finger binding and are characterized by three cysteine residues and one histidine residue, are nucleic acid-binding. Other family members are known to function in post-transcriptional regulation. [provided by RefSeq, Aug 2011]
Mouse(330474) zinc finger CCCH-type containing 4
Rat(678741) zinc finger CCCH-type containing 4
cow(521686) zinc finger CCCH-type containing 4
sheep(101123230) zinc finger CCCH-type containing 4
domestic guinea pig(100718370) zinc finger CCCH-type containing 4
naked mole-rat(101717173) zinc finger CCCH-type containing 4
dog(612160) zinc finger CCCH-type containing 4
Horse(100071206) zinc finger CCCH-type containing 4
domestic cat(101099092) zinc finger CCCH-type containing 4
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198631 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198631 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198631 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015168 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015168 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015168 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030591 MISSION® esiRNA esiRNA human ZC3H4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015168 Rosetta Predictions human pricing
XM_028253 Rosetta Predictions human pricing
XM_934775 Rosetta Predictions human pricing
XM_934776 Rosetta Predictions human pricing
XM_001053214 Rosetta Predictions rat pricing
NM_198631 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015168 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347159 predicted 683
2 SASI_Hs02_00347160 predicted 476
3 SASI_Hs02_00347161 predicted 687
4 SASI_Hs02_00347162 predicted 1359
5 SASI_Hs02_00347163 predicted 333
6 SASI_Hs02_00347164 predicted 696
7 SASI_Hs02_00347165 predicted 565
8 SASI_Hs02_00347166 predicted 603
9 SASI_Hs02_00347167 predicted 1341
10 SASI_Hs02_00347168 predicted 1087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_028253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00284265 predicted 685
2 SASI_Hs01_00284266 predicted 479
3 SASI_Hs01_00284267 predicted 682
4 SASI_Hs01_00284268 predicted 341
5 SASI_Hs01_00284269 predicted 697
6 SASI_Hs01_00284270 predicted 561
7 SASI_Hs01_00284271 predicted 595
8 SASI_Hs01_00284272 predicted 1343
9 SASI_Hs01_00284273 predicted 1085
10 SASI_Hs01_00284274 predicted 2908
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934775 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283081 predicted 300
2 SASI_Hs01_00283082 predicted 358
3 SASI_Hs01_00283083 predicted 148
4 SASI_Hs01_00283084 predicted 452
5 SASI_Hs01_00283085 predicted 315
6 SASI_Hs01_00283086 predicted 178
7 SASI_Hs01_00283087 predicted 400
8 SASI_Hs01_00283088 predicted 308
9 SASI_Hs01_00283089 predicted 305
10 SASI_Hs01_00283090 predicted 414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934776 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274003 predicted 574
2 SASI_Hs01_00274004 predicted 581
3 SASI_Hs01_00274005 predicted 635
4 SASI_Hs01_00274006 predicted 654
5 SASI_Hs01_00274007 predicted 631
6 SASI_Hs01_00274008 predicted 297
7 SASI_Hs01_00274009 predicted 363
8 SASI_Hs01_00274010 predicted 154
9 SASI_Hs01_00274011 predicted 986
10 SASI_Hs01_00274012 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053214 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00271652 predicted 1320
2 SASI_Rn02_00271653 predicted 1315
3 SASI_Rn02_00271654 predicted 433
4 SASI_Rn02_00271655 predicted 913
5 SASI_Rn02_00271656 predicted 395
6 SASI_Rn02_00271657 predicted 565
7 SASI_Rn02_00271658 predicted 2477
8 SASI_Rn02_00271659 predicted 3151
9 SASI_Rn02_00271660 predicted 2080
10 SASI_Rn02_00271661 predicted 3422
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198631 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100499 predicted 451
2 SASI_Mm02_00351087 predicted 1259
3 SASI_Mm02_00351088 predicted 1115
4 SASI_Mm01_00100502 predicted 603
5 SASI_Mm01_00100505 predicted 516
6 SASI_Mm01_00100506 predicted 383
7 SASI_Mm02_00351089 predicted 2388
8 SASI_Mm01_00100507 predicted 610
9 SASI_Mm02_00351090 predicted 1911
10 SASI_Mm02_00351091 predicted 3100
11 SASI_Mm01_00100498 predicted 356
12 SASI_Mm01_00100500 predicted 458
13 SASI_Mm01_00100501 predicted 974
14 SASI_Mm01_00100503 predicted 1015
15 SASI_Mm01_00100504 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198631
ZC3H4 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-1274s21c1
Sequence:CCGGCATGGTGACTTTCCGTGTAAACTCGAGTTTACACGGAAAGTCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-405s21c1
Sequence:CCGGACCGCAAGTACCGGGACTATACTCGAGTATAGTCCCGGTACTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.2-1274s1c1
Sequence:CCGGCATGGTGACTTTCCGTGTAAACTCGAGTTTACACGGAAAGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.2-1207s1c1
Sequence:CCGGGAAGCGAGAGTTGTGCAAATTCTCGAGAATTTGCACAACTCTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-3381s21c1
Sequence:CCGGTGAGTGGTATCAGCTTATATGCTCGAGCATATAAGCTGATACCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198631.2-4016s21c1
Sequence:CCGGGTACTTTCTTTGAGTCATAAACTCGAGTTTATGACTCAAAGAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-846s21c1
Sequence:CCGGACGATGATTACGATGACTATTCTCGAGAATAGTCATCGTAATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198631.1-2849s1c1
Sequence:CCGGCCAAAGAGAAATCCCTTCAAACTCGAGTTTGAAGGGATTTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.1-549s1c1
Sequence:CCGGCGACTTCACCAAAGAACTGAACTCGAGTTCAGTTCTTTGGTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.1-309s1c1
Sequence:CCGGCTTCTCAGATGACTCAGATTTCTCGAGAAATCTGAGTCATCTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198631
ZC3H4 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-1274s21c1
Sequence:CCGGCATGGTGACTTTCCGTGTAAACTCGAGTTTACACGGAAAGTCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-405s21c1
Sequence:CCGGACCGCAAGTACCGGGACTATACTCGAGTATAGTCCCGGTACTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.2-1274s1c1
Sequence:CCGGCATGGTGACTTTCCGTGTAAACTCGAGTTTACACGGAAAGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.2-1207s1c1
Sequence:CCGGGAAGCGAGAGTTGTGCAAATTCTCGAGAATTTGCACAACTCTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-3381s21c1
Sequence:CCGGTGAGTGGTATCAGCTTATATGCTCGAGCATATAAGCTGATACCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198631.2-4016s21c1
Sequence:CCGGGTACTTTCTTTGAGTCATAAACTCGAGTTTATGACTCAAAGAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-846s21c1
Sequence:CCGGACGATGATTACGATGACTATTCTCGAGAATAGTCATCGTAATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198631.1-2849s1c1
Sequence:CCGGCCAAAGAGAAATCCCTTCAAACTCGAGTTTGAAGGGATTTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.1-549s1c1
Sequence:CCGGCGACTTCACCAAAGAACTGAACTCGAGTTCAGTTCTTTGGTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.1-309s1c1
Sequence:CCGGCTTCTCAGATGACTCAGATTTCTCGAGAAATCTGAGTCATCTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198631
ZC3H4 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-1274s21c1
Sequence:CCGGCATGGTGACTTTCCGTGTAAACTCGAGTTTACACGGAAAGTCACCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-405s21c1
Sequence:CCGGACCGCAAGTACCGGGACTATACTCGAGTATAGTCCCGGTACTTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216658    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.2-1274s1c1
Sequence:CCGGCATGGTGACTTTCCGTGTAAACTCGAGTTTACACGGAAAGTCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.2-1207s1c1
Sequence:CCGGGAAGCGAGAGTTGTGCAAATTCTCGAGAATTTGCACAACTCTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-3381s21c1
Sequence:CCGGTGAGTGGTATCAGCTTATATGCTCGAGCATATAAGCTGATACCACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198631.2-4016s21c1
Sequence:CCGGGTACTTTCTTTGAGTCATAAACTCGAGTTTATGACTCAAAGAAAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198631.2-846s21c1
Sequence:CCGGACGATGATTACGATGACTATTCTCGAGAATAGTCATCGTAATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192488    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198631.1-2849s1c1
Sequence:CCGGCCAAAGAGAAATCCCTTCAAACTCGAGTTTGAAGGGATTTCTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.1-549s1c1
Sequence:CCGGCGACTTCACCAAAGAACTGAACTCGAGTTCAGTTCTTTGGTGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198631.1-309s1c1
Sequence:CCGGCTTCTCAGATGACTCAGATTTCTCGAGAAATCTGAGTCATCTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015168
VALIDATED
ZC3H4 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015168.1-4744s21c1
Sequence:CCGGACGCACGTTCTGTCAGTATTACTCGAGTAATACTGACAGAACGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-928s21c1
Sequence:CCGGCAATGGGAGACGACGACTATGCTCGAGCATAGTCGTCGTCTCCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-1355s21c1
Sequence:CCGGCCCTTATATGCACGGTGATTTCTCGAGAAATCACCGTGCATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-453s21c1
Sequence:CCGGTTCTCAGATGACTCGGATTTCCTCGAGGAAATCCGAGTCATCTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015168.1-613s21c1
Sequence:CCGGTGTACGAGGACTACGAGAATGCTCGAGCATTCTCGTAGTCCTCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015168
VALIDATED
ZC3H4 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015168.1-4744s21c1
Sequence:CCGGACGCACGTTCTGTCAGTATTACTCGAGTAATACTGACAGAACGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-928s21c1
Sequence:CCGGCAATGGGAGACGACGACTATGCTCGAGCATAGTCGTCGTCTCCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-1355s21c1
Sequence:CCGGCCCTTATATGCACGGTGATTTCTCGAGAAATCACCGTGCATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-453s21c1
Sequence:CCGGTTCTCAGATGACTCGGATTTCCTCGAGGAAATCCGAGTCATCTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015168.1-613s21c1
Sequence:CCGGTGTACGAGGACTACGAGAATGCTCGAGCATTCTCGTAGTCCTCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015168
VALIDATED
ZC3H4 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239295    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015168.1-4744s21c1
Sequence:CCGGACGCACGTTCTGTCAGTATTACTCGAGTAATACTGACAGAACGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-928s21c1
Sequence:CCGGCAATGGGAGACGACGACTATGCTCGAGCATAGTCGTCGTCTCCCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-1355s21c1
Sequence:CCGGCCCTTATATGCACGGTGATTTCTCGAGAAATCACCGTGCATATAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015168.1-453s21c1
Sequence:CCGGTTCTCAGATGACTCGGATTTCCTCGAGGAAATCCGAGTCATCTGAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_015168.1-613s21c1
Sequence:CCGGTGTACGAGGACTACGAGAATGCTCGAGCATTCTCGTAGTCCTCGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks