EMAIL THIS PAGE TO A FRIEND

ZC3H6

zinc finger CCCH-type containing 6

Synonyms: ZC3HDC6
UniProtKB ID: P61129, A9JR71, Q6ZW96
Gene ID:
Mouse(78751) zinc finger CCCH type containing 6
Rat(311415) zinc finger CCCH type containing 6
chicken(421230) zinc finger CCCH-type containing 6
Horse(100064805) zinc finger CCCH-type containing 6
domestic cat(101083073) zinc finger CCCH-type containing 6
dog(475751) zinc finger CCCH-type containing 6
naked mole-rat(101714135) zinc finger CCCH-type containing 6
Domestic Rabbit(100354259) zinc finger CCCH-type containing 6
domestic guinea pig(100713261) zinc finger CCCH-type containing 6
cow(506237) zinc finger CCCH-type containing 6
sheep(101118777) zinc finger CCCH-type containing 6
271 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198581 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198581 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198581 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198581 Rosetta Predictions human pricing
NM_001107772 Rosetta Predictions rat pricing
NM_178404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198581 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085836 predicted 2759
2 SASI_Hs01_00085837 predicted 2937
3 SASI_Hs01_00085839 predicted 1528
4 SASI_Hs02_00372215 predicted 1542
5 SASI_Hs02_00372216 predicted 2086
6 SASI_Hs01_00085842 predicted 2811
7 SASI_Hs02_00372217 predicted 3806
8 SASI_Hs01_00085845 predicted 3219
9 SASI_Hs02_00372218 predicted 1124
10 SASI_Hs02_00372219 predicted 2192
11 SASI_Hs01_00085838 predicted 1271
12 SASI_Hs01_00085840 predicted 614
13 SASI_Hs01_00085841 predicted 707
14 SASI_Hs01_00085843 predicted 414
15 SASI_Hs01_00085844 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232115 predicted 972
2 SASI_Rn02_00232116 predicted 2878
3 SASI_Rn02_00232117 predicted 3038
4 SASI_Rn02_00232118 predicted 3211
5 SASI_Rn02_00232119 predicted 2180
6 SASI_Rn02_00232120 predicted 1354
7 SASI_Rn02_00232121 predicted 1672
8 SASI_Rn02_00232122 predicted 2279
9 SASI_Rn02_00232123 predicted 3308
10 SASI_Rn02_00232124 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186699 predicted 2474
2 SASI_Mm02_00348834 predicted 3213
3 SASI_Mm01_00186702 predicted 3932
4 SASI_Mm01_00186703 predicted 1383
5 SASI_Mm01_00186704 predicted 3993
6 SASI_Mm01_00186705 predicted 1703
7 SASI_Mm02_00348835 predicted 855
8 SASI_Mm02_00348836 predicted 1962
9 SASI_Mm01_00186706 predicted 3186
10 SASI_Mm01_00186707 predicted 1726
11 SASI_Mm01_00186698 predicted 1184
12 SASI_Mm01_00186700 predicted 2205
13 SASI_Mm01_00186701 predicted 269
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178404
ZC3H6 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178404.2-3180s1c1
Sequence:CCGGCCAGTTGTCTTTCTTAATCATCTCGAGATGATTAAGAAAGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-1851s1c1
Sequence:CCGGCCTTCTTAATACCTTTGGATTCTCGAGAATCCAAAGGTATTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-1751s1c1
Sequence:CCGGGCAGAGTTTGACTTACGTCATCTCGAGATGACGTAAGTCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-2489s1c1
Sequence:CCGGCCTAGGGATAAAGGTTCGTTACTCGAGTAACGAACCTTTATCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-449s1c1
Sequence:CCGGGCGGATGAAGAACTTGTAAATCTCGAGATTTACAAGTTCTTCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-861s21c1
Sequence:CCGGATGACAACTTTGGTAACTATACTCGAGTATAGTTACCAAAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-3035s21c1
Sequence:CCGGGACTTACTTCCAGTACCTTTACTCGAGTAAAGGTACTGGAAGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-2609s21c1
Sequence:CCGGACTGATCCAAGACTCGCTAAACTCGAGTTTAGCGAGTCTTGGATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-1172s21c1
Sequence:CCGGGTTATGACTCAGGAGTTTATTCTCGAGAATAAACTCCTGAGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178404
ZC3H6 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178404.2-3180s1c1
Sequence:CCGGCCAGTTGTCTTTCTTAATCATCTCGAGATGATTAAGAAAGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-1851s1c1
Sequence:CCGGCCTTCTTAATACCTTTGGATTCTCGAGAATCCAAAGGTATTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-1751s1c1
Sequence:CCGGGCAGAGTTTGACTTACGTCATCTCGAGATGACGTAAGTCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-2489s1c1
Sequence:CCGGCCTAGGGATAAAGGTTCGTTACTCGAGTAACGAACCTTTATCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-449s1c1
Sequence:CCGGGCGGATGAAGAACTTGTAAATCTCGAGATTTACAAGTTCTTCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-861s21c1
Sequence:CCGGATGACAACTTTGGTAACTATACTCGAGTATAGTTACCAAAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-3035s21c1
Sequence:CCGGGACTTACTTCCAGTACCTTTACTCGAGTAAAGGTACTGGAAGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-2609s21c1
Sequence:CCGGACTGATCCAAGACTCGCTAAACTCGAGTTTAGCGAGTCTTGGATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-1172s21c1
Sequence:CCGGGTTATGACTCAGGAGTTTATTCTCGAGAATAAACTCCTGAGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178404
ZC3H6 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086308    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178404.2-3180s1c1
Sequence:CCGGCCAGTTGTCTTTCTTAATCATCTCGAGATGATTAAGAAAGACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-1851s1c1
Sequence:CCGGCCTTCTTAATACCTTTGGATTCTCGAGAATCCAAAGGTATTAAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-1751s1c1
Sequence:CCGGGCAGAGTTTGACTTACGTCATCTCGAGATGACGTAAGTCAAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086312    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-2489s1c1
Sequence:CCGGCCTAGGGATAAAGGTTCGTTACTCGAGTAACGAACCTTTATCCCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086310    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178404.2-449s1c1
Sequence:CCGGGCGGATGAAGAACTTGTAAATCTCGAGATTTACAAGTTCTTCATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-861s21c1
Sequence:CCGGATGACAACTTTGGTAACTATACTCGAGTATAGTTACCAAAGTTGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-3035s21c1
Sequence:CCGGGACTTACTTCCAGTACCTTTACTCGAGTAAAGGTACTGGAAGTAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-2609s21c1
Sequence:CCGGACTGATCCAAGACTCGCTAAACTCGAGTTTAGCGAGTCTTGGATCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178404.3-1172s21c1
Sequence:CCGGGTTATGACTCAGGAGTTTATTCTCGAGAATAAACTCCTGAGTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198581
VALIDATED
ZC3H6 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3990s1c1
Sequence:CCGGGCTAGTATAGTCAACAGTATTCTCGAGAATACTGTTGACTATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3032s1c1
Sequence:CCGGGCTATTGTGTAACTGAGCAATCTCGAGATTGCTCAGTTACACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3747s1c1
Sequence:CCGGGCAATTAGTTACTGCTGTGTTCTCGAGAACACAGCAGTAACTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-2663s21c1
Sequence:CCGGGACCCTAGGCTTAGGACTATCCTCGAGGATAGTCCTAAGCCTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198581.2-5176s21c1
Sequence:CCGGATTAGACTGCTACTCATATTTCTCGAGAAATATGAGTAGCAGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-1168s21c1
Sequence:CCGGGGTTATGACTCAGGAATTTATCTCGAGATAAATTCCTGAGTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-2139s21c1
Sequence:CCGGTGCAGCTCAACACCAATTATGCTCGAGCATAATTGGTGTTGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-1436s21c1
Sequence:CCGGTCCCATGATGATCTAACTAAACTCGAGTTTAGTTAGATCATCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198581
VALIDATED
ZC3H6 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3990s1c1
Sequence:CCGGGCTAGTATAGTCAACAGTATTCTCGAGAATACTGTTGACTATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3032s1c1
Sequence:CCGGGCTATTGTGTAACTGAGCAATCTCGAGATTGCTCAGTTACACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3747s1c1
Sequence:CCGGGCAATTAGTTACTGCTGTGTTCTCGAGAACACAGCAGTAACTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-2663s21c1
Sequence:CCGGGACCCTAGGCTTAGGACTATCCTCGAGGATAGTCCTAAGCCTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198581.2-5176s21c1
Sequence:CCGGATTAGACTGCTACTCATATTTCTCGAGAAATATGAGTAGCAGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-1168s21c1
Sequence:CCGGGGTTATGACTCAGGAATTTATCTCGAGATAAATTCCTGAGTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-2139s21c1
Sequence:CCGGTGCAGCTCAACACCAATTATGCTCGAGCATAATTGGTGTTGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-1436s21c1
Sequence:CCGGTCCCATGATGATCTAACTAAACTCGAGTTTAGTTAGATCATCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198581
VALIDATED
ZC3H6 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183500    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3990s1c1
Sequence:CCGGGCTAGTATAGTCAACAGTATTCTCGAGAATACTGTTGACTATACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150192    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3032s1c1
Sequence:CCGGGCTATTGTGTAACTGAGCAATCTCGAGATTGCTCAGTTACACAATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147978    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198581.1-3747s1c1
Sequence:CCGGGCAATTAGTTACTGCTGTGTTCTCGAGAACACAGCAGTAACTAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-2663s21c1
Sequence:CCGGGACCCTAGGCTTAGGACTATCCTCGAGGATAGTCCTAAGCCTAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198581.2-5176s21c1
Sequence:CCGGATTAGACTGCTACTCATATTTCTCGAGAAATATGAGTAGCAGTCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-1168s21c1
Sequence:CCGGGGTTATGACTCAGGAATTTATCTCGAGATAAATTCCTGAGTCATAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-2139s21c1
Sequence:CCGGTGCAGCTCAACACCAATTATGCTCGAGCATAATTGGTGTTGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_198581.2-1436s21c1
Sequence:CCGGTCCCATGATGATCTAACTAAACTCGAGTTTAGTTAGATCATCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks