EMAIL THIS PAGE TO A FRIEND

ZC3H7A

zinc finger CCCH-type containing 7A

Synonyms: ZC3H7 ZC3HDC7
UniProtKB ID: Q8IWR0, D3DUG5, Q9NPE9
Gene ID:
Mouse(106205) zinc finger CCCH type containing 7 A
Rat(360466) zinc finger CCCH type containing 7 A
cow(540922) zinc finger CCCH-type containing 7A
sheep(101109932) zinc finger CCCH-type containing 7A
domestic guinea pig(100730304) zinc finger CCCH-type containing 7A
naked mole-rat(101724004) zinc finger CCCH-type containing 7A
Zebrafish(406743) zinc finger CCCH-type containing 7A
Horse(100050963) zinc finger CCCH-type containing 7A
chicken(416426) zinc finger CCCH-type containing 7A
dog(479848) zinc finger CCCH-type containing 7A
domestic cat(101082795) zinc finger CCCH-type containing 7A
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145931 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145931 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145931 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014153 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014153 Rosetta Predictions human pricing
NM_001108262 Rosetta Predictions rat pricing
NM_145931 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058741 predicted 1755
2 SASI_Hs01_00058742 predicted 619
3 SASI_Hs01_00058743 predicted 1085
4 SASI_Hs01_00058744 predicted 301
5 SASI_Hs01_00058745 predicted 480
6 SASI_Hs01_00058746 predicted 1570
7 SASI_Hs01_00058747 predicted 2205
8 SASI_Hs01_00058749 predicted 1286
9 SASI_Hs01_00058750 predicted 343
10 SASI_Hs02_00345143 predicted 1364
11 SASI_Hs01_00058748 predicted 3049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236924 predicted 1515
2 SASI_Rn02_00236925 predicted 1981
3 SASI_Rn02_00236926 predicted 1949
4 SASI_Rn02_00236927 predicted 1955
5 SASI_Rn02_00236928 predicted 428
6 SASI_Rn02_00236929 predicted 435
7 SASI_Rn02_00236930 predicted 1202
8 SASI_Rn02_00236931 predicted 2004
9 SASI_Rn02_00236932 predicted 1158
10 SASI_Rn02_00236933 predicted 2077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00192718 predicted 1268
2 SASI_Mm01_00192719 predicted 1477
3 SASI_Mm01_00192720 predicted 1762
4 SASI_Mm02_00341385 predicted 2326
5 SASI_Mm02_00341386 predicted 2094
6 SASI_Mm01_00192721 predicted 2402
7 SASI_Mm01_00192722 predicted 491
8 SASI_Mm01_00192724 predicted 2411
9 SASI_Mm01_00192725 predicted 809
10 SASI_Mm01_00192727 predicted 648
11 SASI_Mm01_00192723 predicted 1651
12 SASI_Mm01_00192726 predicted 2047
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145931
VALIDATED
ZC3H7A MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 7A
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-1378s21c1
Sequence:CCGGTATGAATGGACCAGGTAATTTCTCGAGAAATTACCTGGTCCATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-3523s21c1
Sequence:CCGGATCTGTATGTAGGTTGCTAAACTCGAGTTTAGCAACCTACATACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145931.2-2519s21c1
Sequence:CCGGTTTGATCTATGCAACCATATTCTCGAGAATATGGTTGCATAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145931.1-1632s1c1
Sequence:CCGGGCAGATGATGAATGCCGATATCTCGAGATATCGGCATTCATCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145931.1-1240s1c1
Sequence:CCGGCACCGCTTAACAACAGTAATTCTCGAGAATTACTGTTGTTAAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-412s21c1
Sequence:CCGGAGCTTTGAGTATAGCTAATTACTCGAGTAATTAGCTATACTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145931.2-2108s21c1
Sequence:CCGGTGTCGACATGAAGTTCGTTATCTCGAGATAACGAACTTCATGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145931.1-3094s1c1
Sequence:CCGGGCTGCAGATTTCTGCTTGATTCTCGAGAATCAAGCAGAAATCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145931.1-3343s1c1
Sequence:CCGGCGGAGTACATGATGGATGAAACTCGAGTTTCATCCATCATGTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145931.1-603s1c1
Sequence:CCGGGCTCAGAAATTGGGATTTAAACTCGAGTTTAAATCCCAATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145931.1-982s1c1
Sequence:CCGGCAGAAACAAATGATGCTGTTACTCGAGTAACAGCATCATTTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145931.1-2425s1c1
Sequence:CCGGGCAACCATATTGCTAATAGAACTCGAGTTCTATTAGCAATATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145931
VALIDATED
ZC3H7A MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 7A
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-1378s21c1
Sequence:CCGGTATGAATGGACCAGGTAATTTCTCGAGAAATTACCTGGTCCATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-3523s21c1
Sequence:CCGGATCTGTATGTAGGTTGCTAAACTCGAGTTTAGCAACCTACATACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145931.2-2519s21c1
Sequence:CCGGTTTGATCTATGCAACCATATTCTCGAGAATATGGTTGCATAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145931.1-1632s1c1
Sequence:CCGGGCAGATGATGAATGCCGATATCTCGAGATATCGGCATTCATCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145931.1-1240s1c1
Sequence:CCGGCACCGCTTAACAACAGTAATTCTCGAGAATTACTGTTGTTAAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-412s21c1
Sequence:CCGGAGCTTTGAGTATAGCTAATTACTCGAGTAATTAGCTATACTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145931.2-2108s21c1
Sequence:CCGGTGTCGACATGAAGTTCGTTATCTCGAGATAACGAACTTCATGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145931.1-3094s1c1
Sequence:CCGGGCTGCAGATTTCTGCTTGATTCTCGAGAATCAAGCAGAAATCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145931.1-3343s1c1
Sequence:CCGGCGGAGTACATGATGGATGAAACTCGAGTTTCATCCATCATGTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145931.1-603s1c1
Sequence:CCGGGCTCAGAAATTGGGATTTAAACTCGAGTTTAAATCCCAATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145931.1-982s1c1
Sequence:CCGGCAGAAACAAATGATGCTGTTACTCGAGTAACAGCATCATTTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145931.1-2425s1c1
Sequence:CCGGGCAACCATATTGCTAATAGAACTCGAGTTCTATTAGCAATATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145931
VALIDATED
ZC3H7A MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 7A
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-1378s21c1
Sequence:CCGGTATGAATGGACCAGGTAATTTCTCGAGAAATTACCTGGTCCATTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322504    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-3523s21c1
Sequence:CCGGATCTGTATGTAGGTTGCTAAACTCGAGTTTAGCAACCTACATACAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145931.2-2519s21c1
Sequence:CCGGTTTGATCTATGCAACCATATTCTCGAGAATATGGTTGCATAGATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145931.1-1632s1c1
Sequence:CCGGGCAGATGATGAATGCCGATATCTCGAGATATCGGCATTCATCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216154    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145931.1-1240s1c1
Sequence:CCGGCACCGCTTAACAACAGTAATTCTCGAGAATTACTGTTGTTAAGCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145931.2-412s21c1
Sequence:CCGGAGCTTTGAGTATAGCTAATTACTCGAGTAATTAGCTATACTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145931.2-2108s21c1
Sequence:CCGGTGTCGACATGAAGTTCGTTATCTCGAGATAACGAACTTCATGTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201879    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145931.1-3094s1c1
Sequence:CCGGGCTGCAGATTTCTGCTTGATTCTCGAGAATCAAGCAGAAATCTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190986    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145931.1-3343s1c1
Sequence:CCGGCGGAGTACATGATGGATGAAACTCGAGTTTCATCCATCATGTACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145931.1-603s1c1
Sequence:CCGGGCTCAGAAATTGGGATTTAAACTCGAGTTTAAATCCCAATTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145931.1-982s1c1
Sequence:CCGGCAGAAACAAATGATGCTGTTACTCGAGTAACAGCATCATTTGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145931.1-2425s1c1
Sequence:CCGGGCAACCATATTGCTAATAGAACTCGAGTTCTATTAGCAATATGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014153
VALIDATED
ZC3H7A MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 7A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014153.2-3312s1c1
Sequence:CCGGCAGATGGTGAAGTGACTGCTACTCGAGTAGCAGTCACTTCACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-2272s1c1
Sequence:CCGGGCGCAGGTACTTGGTAATCAACTCGAGTTGATTACCAAGTACCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-290s1c1
Sequence:CCGGCACAGGAGCAATATGCGGTATCTCGAGATACCGCATATTGCTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-2431s1c1
Sequence:CCGGGCGATGAGAGTGATGTCTATTCTCGAGAATAGACATCACTCTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-1987s1c1
Sequence:CCGGCCGGTTACAAAGCATGAGTTTCTCGAGAAACTCATGCTTTGTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-488s1c1
Sequence:CCGGCCTGCTATTCTAATATGGGTTCTCGAGAACCCATATTAGAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-2968s1c1
Sequence:CCGGGCACATGGAAATGCCGAACTTCTCGAGAAGTTCGGCATTTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014153.2-3425s1c1
Sequence:CCGGCATATAAGAATCGTGACGGTACTCGAGTACCGTCACGATTCTTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-1463s1c1
Sequence:CCGGCAGTTACCAAACCATCTTCATCTCGAGATGAAGATGGTTTGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014153
VALIDATED
ZC3H7A MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 7A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014153.2-3312s1c1
Sequence:CCGGCAGATGGTGAAGTGACTGCTACTCGAGTAGCAGTCACTTCACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-2272s1c1
Sequence:CCGGGCGCAGGTACTTGGTAATCAACTCGAGTTGATTACCAAGTACCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-290s1c1
Sequence:CCGGCACAGGAGCAATATGCGGTATCTCGAGATACCGCATATTGCTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-2431s1c1
Sequence:CCGGGCGATGAGAGTGATGTCTATTCTCGAGAATAGACATCACTCTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-1987s1c1
Sequence:CCGGCCGGTTACAAAGCATGAGTTTCTCGAGAAACTCATGCTTTGTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-488s1c1
Sequence:CCGGCCTGCTATTCTAATATGGGTTCTCGAGAACCCATATTAGAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-2968s1c1
Sequence:CCGGGCACATGGAAATGCCGAACTTCTCGAGAAGTTCGGCATTTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014153.2-3425s1c1
Sequence:CCGGCATATAAGAATCGTGACGGTACTCGAGTACCGTCACGATTCTTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-1463s1c1
Sequence:CCGGCAGTTACCAAACCATCTTCATCTCGAGATGAAGATGGTTTGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014153
VALIDATED
ZC3H7A MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 7A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166807    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014153.2-3312s1c1
Sequence:CCGGCAGATGGTGAAGTGACTGCTACTCGAGTAGCAGTCACTTCACCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165008    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-2272s1c1
Sequence:CCGGGCGCAGGTACTTGGTAATCAACTCGAGTTGATTACCAAGTACCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-290s1c1
Sequence:CCGGCACAGGAGCAATATGCGGTATCTCGAGATACCGCATATTGCTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-2431s1c1
Sequence:CCGGGCGATGAGAGTGATGTCTATTCTCGAGAATAGACATCACTCTCATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-1987s1c1
Sequence:CCGGCCGGTTACAAAGCATGAGTTTCTCGAGAAACTCATGCTTTGTAACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160466    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014153.2-488s1c1
Sequence:CCGGCCTGCTATTCTAATATGGGTTCTCGAGAACCCATATTAGAATAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-2968s1c1
Sequence:CCGGGCACATGGAAATGCCGAACTTCTCGAGAAGTTCGGCATTTCCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158501    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014153.2-3425s1c1
Sequence:CCGGCATATAAGAATCGTGACGGTACTCGAGTACCGTCACGATTCTTATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014153.2-1463s1c1
Sequence:CCGGCAGTTACCAAACCATCTTCATCTCGAGATGAAGATGGTTTGGTAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks