EMAIL THIS PAGE TO A FRIEND

ZC3H7B

zinc finger CCCH-type containing 7B

Synonyms: RoXaN
Gene ID:
Human(23264) Summary: This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]
Mouse(20286) zinc finger CCCH type containing 7B
Rat(315158) zinc finger CCCH-type containing 7B
Zebrafish(557754) zinc finger CCCH-type containing 7B
Horse(100070641) zinc finger CCCH-type containing 7B
chicken(417996) zinc finger CCCH-type containing 7B
dog(474490) zinc finger CCCH-type containing 7B
domestic cat(101100233) zinc finger CCCH-type containing 7B
naked mole-rat(101707561) zinc finger CCCH-type containing 7B
Domestic Rabbit(100353874) zinc finger CCCH-type containing 7B
domestic guinea pig(100715320) zinc finger CCCH-type containing 7B
cow(534109) zinc finger CCCH-type containing 7B
sheep(101110667) zinc finger CCCH-type containing 7B
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017590 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017590 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017590 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081016 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081016 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081016 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU174331 MISSION® esiRNA esiRNA targeting mouse Zc3h7b mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017590 Rosetta Predictions human pricing
NM_001130695 Rosetta Predictions rat pricing
NM_001081016 Rosetta Predictions mouse pricing
XM_001001575 Rosetta Predictions mouse pricing
XM_001001589 Rosetta Predictions mouse pricing
XM_001001617 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017590 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159992 predicted 1649
2 SASI_Hs02_00350255 predicted 2610
3 SASI_Hs02_00350256 predicted 1878
4 SASI_Hs02_00350257 predicted 334
5 SASI_Hs02_00350258 predicted 1664
6 SASI_Hs02_00350259 predicted 2610
7 SASI_Hs02_00350260 predicted 811
8 SASI_Hs02_00350261 predicted 299
9 SASI_Hs02_00350262 predicted 2339
10 SASI_Hs02_00350263 predicted 783
11 SASI_Hs01_00159993 predicted 1534
12 SASI_Hs01_00159994 predicted 551
13 SASI_Hs01_00159995 predicted 1952
14 SASI_Hs01_00159996 predicted 2709
15 SASI_Hs01_00159997 predicted 259
16 SASI_Hs01_00159998 predicted 2168
17 SASI_Hs01_00159999 predicted 2183
18 SASI_Hs01_00160000 predicted 2872
19 SASI_Hs01_00160001 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001130695 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256029 predicted 607
2 SASI_Rn02_00256030 predicted 1480
3 SASI_Rn02_00256031 predicted 2388
4 SASI_Rn02_00256032 predicted 1497
5 SASI_Rn02_00256033 predicted 2421
6 SASI_Rn02_00256034 predicted 2429
7 SASI_Rn02_00256035 predicted 1697
8 SASI_Rn02_00256036 predicted 230
9 SASI_Rn02_00256037 predicted 1500
10 SASI_Rn02_00256038 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081016 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294396 predicted 1942
2 SASI_Mm02_00294397 predicted 2858
3 SASI_Mm02_00294398 predicted 1064
4 SASI_Mm02_00294399 predicted 837
5 SASI_Mm02_00294400 predicted 2765
6 SASI_Mm02_00294401 predicted 2996
7 SASI_Mm02_00294402 predicted 701
8 SASI_Mm02_00294403 predicted 1959
9 SASI_Mm02_00294404 predicted 2882
10 SASI_Mm02_00294405 predicted 2583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00260286 predicted 1323
2 SASI_Mm01_00260287 predicted 2160
3 SASI_Mm01_00260288 predicted 2133
4 SASI_Mm01_00260289 predicted 2224
5 SASI_Mm01_00260290 predicted 2168
6 SASI_Mm01_00260291 predicted 2217
7 SASI_Mm01_00260292 predicted 2307
8 SASI_Mm01_00260293 predicted 1962
9 SASI_Mm01_00260294 predicted 1326
10 SASI_Mm01_00260295 predicted 2336
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238542 predicted 1930
2 SASI_Mm01_00238543 predicted 1079
3 SASI_Mm01_00238544 predicted 619
4 SASI_Mm01_00238545 predicted 1057
5 SASI_Mm01_00238546 predicted 825
6 SASI_Mm01_00238547 predicted 685
7 SASI_Mm01_00238548 predicted 1944
8 SASI_Mm01_00238549 predicted 1935
9 SASI_Mm01_00238550 predicted 772
10 SASI_Mm01_00238551 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001001617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00228329 predicted 1949
2 SASI_Mm01_00228330 predicted 2863
3 SASI_Mm01_00228331 predicted 1078
4 SASI_Mm01_00228332 predicted 841
5 SASI_Mm01_00228333 predicted 2776
6 SASI_Mm01_00228334 predicted 3009
7 SASI_Mm01_00228335 predicted 698
8 SASI_Mm01_00228336 predicted 1960
9 SASI_Mm01_00228337 predicted 2888
10 SASI_Mm01_00228338 predicted 2587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017590
VALIDATED
ZC3H7B MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 7B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017590.4-2352s1c1
Sequence:CCGGCCTCAAGTACTGTAGTGCCAACTCGAGTTGGCACTACAGTACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017590.4-5292s1c1
Sequence:CCGGGCTCAGGGAAAGAAGGTGATTCTCGAGAATCACCTTCTTTCCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017590.4-1878s1c1
Sequence:CCGGCGAGATCTGCTTTGACAGTAACTCGAGTTACTGTCAAAGCAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017590.4-4964s1c1
Sequence:CCGGGCCTTGTTTCTAGTGTGTATACTCGAGTATACACACTAGAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017590.4-2482s1c1
Sequence:CCGGCAATACGATCTCTGCATCCATCTCGAGATGGATGCAGAGATCGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017590.4-3045s1c1
Sequence:CCGGCGACGACTTTGGCAAATACAACTCGAGTTGTATTTGCCAAAGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-711s21c1
Sequence:CCGGGCGAGTTCGCAAGGCGTATAACTCGAGTTATACGCCTTGCGAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-459s21c1
Sequence:CCGGGTGCAAGCTGCATGTCAATAGCTCGAGCTATTGACATGCAGCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-1664s21c1
Sequence:CCGGACCTGTGCAAAGACATGATTACTCGAGTAATCATGTCTTTGCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-2466s21c1
Sequence:CCGGTCGTAACTTCCCACAGCAATACTCGAGTATTGCTGTGGGAAGTTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-259s21c1
Sequence:CCGGCAGTTCATTCAGTCGACACTACTCGAGTAGTGTCGACTGAATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017590
VALIDATED
ZC3H7B MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 7B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017590.4-2352s1c1
Sequence:CCGGCCTCAAGTACTGTAGTGCCAACTCGAGTTGGCACTACAGTACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017590.4-5292s1c1
Sequence:CCGGGCTCAGGGAAAGAAGGTGATTCTCGAGAATCACCTTCTTTCCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017590.4-1878s1c1
Sequence:CCGGCGAGATCTGCTTTGACAGTAACTCGAGTTACTGTCAAAGCAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017590.4-4964s1c1
Sequence:CCGGGCCTTGTTTCTAGTGTGTATACTCGAGTATACACACTAGAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017590.4-2482s1c1
Sequence:CCGGCAATACGATCTCTGCATCCATCTCGAGATGGATGCAGAGATCGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017590.4-3045s1c1
Sequence:CCGGCGACGACTTTGGCAAATACAACTCGAGTTGTATTTGCCAAAGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-711s21c1
Sequence:CCGGGCGAGTTCGCAAGGCGTATAACTCGAGTTATACGCCTTGCGAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-459s21c1
Sequence:CCGGGTGCAAGCTGCATGTCAATAGCTCGAGCTATTGACATGCAGCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-1664s21c1
Sequence:CCGGACCTGTGCAAAGACATGATTACTCGAGTAATCATGTCTTTGCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-2466s21c1
Sequence:CCGGTCGTAACTTCCCACAGCAATACTCGAGTATTGCTGTGGGAAGTTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-259s21c1
Sequence:CCGGCAGTTCATTCAGTCGACACTACTCGAGTAGTGTCGACTGAATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017590
VALIDATED
ZC3H7B MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 7B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_017590.4-2352s1c1
Sequence:CCGGCCTCAAGTACTGTAGTGCCAACTCGAGTTGGCACTACAGTACTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157100    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017590.4-5292s1c1
Sequence:CCGGGCTCAGGGAAAGAAGGTGATTCTCGAGAATCACCTTCTTTCCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156115    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_017590.4-1878s1c1
Sequence:CCGGCGAGATCTGCTTTGACAGTAACTCGAGTTACTGTCAAAGCAGATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153072    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017590.4-4964s1c1
Sequence:CCGGGCCTTGTTTCTAGTGTGTATACTCGAGTATACACACTAGAAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156005    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017590.4-2482s1c1
Sequence:CCGGCAATACGATCTCTGCATCCATCTCGAGATGGATGCAGAGATCGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017590.4-3045s1c1
Sequence:CCGGCGACGACTTTGGCAAATACAACTCGAGTTGTATTTGCCAAAGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-711s21c1
Sequence:CCGGGCGAGTTCGCAAGGCGTATAACTCGAGTTATACGCCTTGCGAACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-459s21c1
Sequence:CCGGGTGCAAGCTGCATGTCAATAGCTCGAGCTATTGACATGCAGCTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-1664s21c1
Sequence:CCGGACCTGTGCAAAGACATGATTACTCGAGTAATCATGTCTTTGCACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-2466s21c1
Sequence:CCGGTCGTAACTTCCCACAGCAATACTCGAGTATTGCTGTGGGAAGTTACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017590.4-259s21c1
Sequence:CCGGCAGTTCATTCAGTCGACACTACTCGAGTAGTGTCGACTGAATGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081016
VALIDATED
ZC3H7B MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 7B
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000240662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-2399s21c1
Sequence:CCGGTGCCACTTCGCCCATAGTTTCCTCGAGGAAACTATGGGCGAAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-1094s21c1
Sequence:CCGGTCTAACGGATTGGGATCTATACTCGAGTATAGATCCCAATCCGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-1001s21c1
Sequence:CCGGCGGGTACGGAAAGCCTATAAGCTCGAGCTTATAGGCTTTCCGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-4877s21c1
Sequence:CCGGGATAGGCACCTGGGCATAAAGCTCGAGCTTTATGCCCAGGTGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081016
VALIDATED
ZC3H7B MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 7B
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000240662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-2399s21c1
Sequence:CCGGTGCCACTTCGCCCATAGTTTCCTCGAGGAAACTATGGGCGAAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-1094s21c1
Sequence:CCGGTCTAACGGATTGGGATCTATACTCGAGTATAGATCCCAATCCGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-1001s21c1
Sequence:CCGGCGGGTACGGAAAGCCTATAAGCTCGAGCTTATAGGCTTTCCGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-4877s21c1
Sequence:CCGGGATAGGCACCTGGGCATAAAGCTCGAGCTTTATGCCCAGGTGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081016
VALIDATED
ZC3H7B MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 7B
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000240662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-2399s21c1
Sequence:CCGGTGCCACTTCGCCCATAGTTTCCTCGAGGAAACTATGGGCGAAGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-1094s21c1
Sequence:CCGGTCTAACGGATTGGGATCTATACTCGAGTATAGATCCCAATCCGTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-1001s21c1
Sequence:CCGGCGGGTACGGAAAGCCTATAAGCTCGAGCTTATAGGCTTTCCGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240659    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081016.1-4877s21c1
Sequence:CCGGGATAGGCACCTGGGCATAAAGCTCGAGCTTTATGCCCAGGTGCCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks