EMAIL THIS PAGE TO A FRIEND

ZC3H8

zinc finger CCCH-type containing 8

Synonyms: Fliz1 ZC3HDC8
UniProtKB ID: Q8N5P1, Q9BZ75
Gene ID:
Mouse(57432) zinc finger CCCH type containing 8
Rat(311414) zinc finger CCCH type containing 8
cow(506983) zinc finger CCCH-type containing 8
sheep(101118772) zinc finger CCCH-type containing 8
domestic guinea pig(100713537) zinc finger CCCH-type containing 8
naked mole-rat(101717401) zinc finger CCCH-type containing 8
domestic cat(101083331) zinc finger CCCH-type containing 8
dog(483063) zinc finger CCCH-type containing 8
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020594 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020594 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020594 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032494 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032494 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032494 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032494 Rosetta Predictions human pricing
NM_001012090 Rosetta Predictions rat pricing
XM_575233 Rosetta Predictions rat pricing
NM_020594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032494 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242648 predicted 727
2 SASI_Hs01_00242649 predicted 214
3 SASI_Hs01_00242650 predicted 731
4 SASI_Hs01_00242651 predicted 822
5 SASI_Hs01_00242652 predicted 221
6 SASI_Hs01_00242654 predicted 212
7 SASI_Hs01_00242655 predicted 240
8 SASI_Hs01_00242656 predicted 219
9 SASI_Hs01_00242657 predicted 688
10 SASI_Hs02_00359963 predicted 815
11 SASI_Hs01_00242653 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062273 predicted 1230
2 SASI_Rn01_00062274 predicted 797
3 SASI_Rn01_00062275 predicted 1137
4 SASI_Rn01_00062276 predicted 1012
5 SASI_Rn01_00062277 predicted 998
6 SASI_Rn01_00062278 predicted 1126
7 SASI_Rn02_00200220 predicted 1046
8 SASI_Rn01_00062279 predicted 715
9 SASI_Rn01_00062280 predicted 936
10 SASI_Rn01_00062282 predicted 1107
11 SASI_Rn01_00062281 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152609 predicted 1266
2 SASI_Rn01_00152610 predicted 830
3 SASI_Rn01_00152611 predicted 1172
4 SASI_Rn01_00152612 predicted 1045
5 SASI_Rn01_00152613 predicted 1033
6 SASI_Rn01_00152614 predicted 1158
7 SASI_Rn01_00152615 predicted 746
8 SASI_Rn01_00152616 predicted 969
9 SASI_Rn01_00152617 predicted 293
10 SASI_Rn01_00152618 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325690 predicted 729
2 SASI_Mm01_00027633 predicted 1015
3 SASI_Mm01_00027634 predicted 849
4 SASI_Mm01_00027636 predicted 244
5 SASI_Mm01_00027637 predicted 953
6 SASI_Mm01_00027638 predicted 840
7 SASI_Mm01_00027639 predicted 759
8 SASI_Mm01_00027640 predicted 959
9 SASI_Mm01_00027641 predicted 997
10 SASI_Mm02_00325691 predicted 1020
11 SASI_Mm01_00027635 predicted 218
12 SASI_Mm01_00027642 predicted 818
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020594
VALIDATED
ZC3H8 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-669s21c1
Sequence:CCGGGAGGATGAGTCAAGGCTTTATCTCGAGATAAAGCCTTGACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-1435s21c1
Sequence:CCGGGTAATTCAGAGTTCCACTTTACTCGAGTAAAGTGGAACTCTGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-434s21c1
Sequence:CCGGACGCAGCTCAACCCTCATTACCTCGAGGTAATGAGGGTTGAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-961s21c1
Sequence:CCGGACACAAGAACTATTGGCTAAACTCGAGTTTAGCCAATAGTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-329s21c1
Sequence:CCGGGTAAGGACTATGACCCATATACTCGAGTATATGGGTCATAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020594.1-1414s1c1
Sequence:CCGGGTCAGTAAATACTTTGCACAACTCGAGTTGTGCAAAGTATTTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-255s1c1
Sequence:CCGGCGTGAACAAATTCCCAAGAAACTCGAGTTTCTTGGGAATTTGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-306s1c1
Sequence:CCGGCCAAAGAGTTTGCTACGTAAACTCGAGTTTACGTAGCAAACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-865s1c1
Sequence:CCGGGCCTGTATTTACATAGTGAATCTCGAGATTCACTATGTAAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020594.1-540s1c1
Sequence:CCGGGCTGGTCACAAGAAAGTTAAACTCGAGTTTAACTTTCTTGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020594
VALIDATED
ZC3H8 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-669s21c1
Sequence:CCGGGAGGATGAGTCAAGGCTTTATCTCGAGATAAAGCCTTGACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-1435s21c1
Sequence:CCGGGTAATTCAGAGTTCCACTTTACTCGAGTAAAGTGGAACTCTGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-434s21c1
Sequence:CCGGACGCAGCTCAACCCTCATTACCTCGAGGTAATGAGGGTTGAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-961s21c1
Sequence:CCGGACACAAGAACTATTGGCTAAACTCGAGTTTAGCCAATAGTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-329s21c1
Sequence:CCGGGTAAGGACTATGACCCATATACTCGAGTATATGGGTCATAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020594.1-1414s1c1
Sequence:CCGGGTCAGTAAATACTTTGCACAACTCGAGTTGTGCAAAGTATTTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-255s1c1
Sequence:CCGGCGTGAACAAATTCCCAAGAAACTCGAGTTTCTTGGGAATTTGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-306s1c1
Sequence:CCGGCCAAAGAGTTTGCTACGTAAACTCGAGTTTACGTAGCAAACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-865s1c1
Sequence:CCGGGCCTGTATTTACATAGTGAATCTCGAGATTCACTATGTAAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020594.1-540s1c1
Sequence:CCGGGCTGGTCACAAGAAAGTTAAACTCGAGTTTAACTTTCTTGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020594
VALIDATED
ZC3H8 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-669s21c1
Sequence:CCGGGAGGATGAGTCAAGGCTTTATCTCGAGATAAAGCCTTGACTCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336011    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-1435s21c1
Sequence:CCGGGTAATTCAGAGTTCCACTTTACTCGAGTAAAGTGGAACTCTGAATTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-434s21c1
Sequence:CCGGACGCAGCTCAACCCTCATTACCTCGAGGTAATGAGGGTTGAGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-961s21c1
Sequence:CCGGACACAAGAACTATTGGCTAAACTCGAGTTTAGCCAATAGTTCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020594.2-329s21c1
Sequence:CCGGGTAAGGACTATGACCCATATACTCGAGTATATGGGTCATAGTCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020594.1-1414s1c1
Sequence:CCGGGTCAGTAAATACTTTGCACAACTCGAGTTGTGCAAAGTATTTACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-255s1c1
Sequence:CCGGCGTGAACAAATTCCCAAGAAACTCGAGTTTCTTGGGAATTTGTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-306s1c1
Sequence:CCGGCCAAAGAGTTTGCTACGTAAACTCGAGTTTACGTAGCAAACTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020594.1-865s1c1
Sequence:CCGGGCCTGTATTTACATAGTGAATCTCGAGATTCACTATGTAAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020594.1-540s1c1
Sequence:CCGGGCTGGTCACAAGAAAGTTAAACTCGAGTTTAACTTTCTTGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032494
VALIDATED
ZC3H8 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type containing 8
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-431s21c1
Sequence:CCGGCCTGAAGAATCTACAAAGAAACTCGAGTTTCTTTGTAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-1387s21c1
Sequence:CCGGCATTGGTAGATGGACCATAAACTCGAGTTTATGGTCCATCTACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-232s21c1
Sequence:CCGGTAAACTGGAGTGCGAGCAAATCTCGAGATTTGCTCGCACTCCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032494.2-557s21c1
Sequence:CCGGCCTGGAAACAAAGGATCAAATCTCGAGATTTGATCCTTTGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-930s21c1
Sequence:CCGGCACAAGAATTGTTGGCTAAAGCTCGAGCTTTAGCCAACAATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-492s1c1
Sequence:CCGGGCTGGTCACAAGAATGGCAAACTCGAGTTTGCCATTCTTGTGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-417s1c1
Sequence:CCGGCCTGAAGAATCTACAAAGAAACTCGAGTTTCTTTGTAGATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-1373s1c1
Sequence:CCGGCATTGGTAGATGGACCATAAACTCGAGTTTATGGTCCATCTACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-1264s1c1
Sequence:CCGGCCTCTTCTGATTGATTGGATTCTCGAGAATCCAATCAATCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-159s1c1
Sequence:CCGGGACGAAAGAATCGATGATGAACTCGAGTTCATCATCGATTCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-918s1c1
Sequence:CCGGCAAGAATTGTTGGCTAAAGTTCTCGAGAACTTTAGCCAACAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-620s1c1
Sequence:CCGGGCAGCATTTGAGTCAGGCATTCTCGAGAATGCCTGACTCAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032494
VALIDATED
ZC3H8 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type containing 8
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-431s21c1
Sequence:CCGGCCTGAAGAATCTACAAAGAAACTCGAGTTTCTTTGTAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-1387s21c1
Sequence:CCGGCATTGGTAGATGGACCATAAACTCGAGTTTATGGTCCATCTACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-232s21c1
Sequence:CCGGTAAACTGGAGTGCGAGCAAATCTCGAGATTTGCTCGCACTCCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032494.2-557s21c1
Sequence:CCGGCCTGGAAACAAAGGATCAAATCTCGAGATTTGATCCTTTGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-930s21c1
Sequence:CCGGCACAAGAATTGTTGGCTAAAGCTCGAGCTTTAGCCAACAATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-492s1c1
Sequence:CCGGGCTGGTCACAAGAATGGCAAACTCGAGTTTGCCATTCTTGTGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-417s1c1
Sequence:CCGGCCTGAAGAATCTACAAAGAAACTCGAGTTTCTTTGTAGATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-1373s1c1
Sequence:CCGGCATTGGTAGATGGACCATAAACTCGAGTTTATGGTCCATCTACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-1264s1c1
Sequence:CCGGCCTCTTCTGATTGATTGGATTCTCGAGAATCCAATCAATCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-159s1c1
Sequence:CCGGGACGAAAGAATCGATGATGAACTCGAGTTCATCATCGATTCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-918s1c1
Sequence:CCGGCAAGAATTGTTGGCTAAAGTTCTCGAGAACTTTAGCCAACAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-620s1c1
Sequence:CCGGGCAGCATTTGAGTCAGGCATTCTCGAGAATGCCTGACTCAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032494
VALIDATED
ZC3H8 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type containing 8
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-431s21c1
Sequence:CCGGCCTGAAGAATCTACAAAGAAACTCGAGTTTCTTTGTAGATTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-1387s21c1
Sequence:CCGGCATTGGTAGATGGACCATAAACTCGAGTTTATGGTCCATCTACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-232s21c1
Sequence:CCGGTAAACTGGAGTGCGAGCAAATCTCGAGATTTGCTCGCACTCCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032494.2-557s21c1
Sequence:CCGGCCTGGAAACAAAGGATCAAATCTCGAGATTTGATCCTTTGTTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_032494.2-930s21c1
Sequence:CCGGCACAAGAATTGTTGGCTAAAGCTCGAGCTTTAGCCAACAATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163399    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-492s1c1
Sequence:CCGGGCTGGTCACAAGAATGGCAAACTCGAGTTTGCCATTCTTGTGACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-417s1c1
Sequence:CCGGCCTGAAGAATCTACAAAGAAACTCGAGTTTCTTTGTAGATTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-1373s1c1
Sequence:CCGGCATTGGTAGATGGACCATAAACTCGAGTTTATGGTCCATCTACCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158431    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-1264s1c1
Sequence:CCGGCCTCTTCTGATTGATTGGATTCTCGAGAATCCAATCAATCAGAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_032494.1-159s1c1
Sequence:CCGGGACGAAAGAATCGATGATGAACTCGAGTTCATCATCGATTCTTTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160611    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-918s1c1
Sequence:CCGGCAAGAATTGTTGGCTAAAGTTCTCGAGAACTTTAGCCAACAATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032494.1-620s1c1
Sequence:CCGGGCAGCATTTGAGTCAGGCATTCTCGAGAATGCCTGACTCAAATGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks