EMAIL THIS PAGE TO A FRIEND

ZC3HAV1

zinc finger CCCH-type, antiviral 1

Synonyms: ARTD13 FLB6421 PARP13 ZAP ZC3H2 ZC3HDC2
Gene ID:
Human(56829) Summary: This gene encodes a CCCH-type zinc finger protein that is thought to prevent infection by retroviruses. Studies of the rat homolog indicate that the protein may primarily function to inhibit viral gene expression and induce an innate immunity to viral infection. Alternative splicing occurs at this locus and two variants, each encoding distinct isoforms, are described. [provided by RefSeq, Jul 2008]
Mouse(78781) zinc finger CCCH type, antiviral 1
Rat(252832) zinc finger CCCH type, antiviral 1
chicken(426315) zinc finger CCCH-type, antiviral 1
Horse(100064774) zinc finger CCCH-type, antiviral 1
domestic cat(101101454) zinc finger CCCH-type, antiviral 1
dog(100682901) zinc finger CCCH-type, antiviral 1
naked mole-rat(101720785) zinc finger CCCH-type, antiviral 1
domestic guinea pig(100734184) zinc finger CCCH-type, antiviral 1
cow(614589) zinc finger CCCH-type, antiviral 1
sheep(101110053) zinc finger CCCH-type, antiviral 1
148 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028864 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028864 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028864 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020119 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081401 MISSION® esiRNA esiRNA human ZC3HAV1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020119 Rosetta Predictions human pricing
NM_024625 Rosetta Predictions human pricing
NM_173045 Rosetta Predictions rat pricing
NM_028864 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072895 predicted 1698
2 SASI_Hs01_00072896 predicted 2115
3 SASI_Hs01_00072897 predicted 1854
4 SASI_Hs01_00072898 predicted 2184
5 SASI_Hs01_00072899 predicted 2080
6 SASI_Hs01_00072900 predicted 709
7 SASI_Hs01_00072901 predicted 2085
8 SASI_Hs01_00072902 predicted 2230
9 SASI_Hs01_00072903 predicted 1139
10 SASI_Hs01_00072904 predicted 2092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024625 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174622 predicted 1700
2 SASI_Hs01_00174623 predicted 2113
3 SASI_Hs01_00174624 predicted 1850
4 SASI_Hs01_00174625 predicted 2189
5 SASI_Hs01_00174626 predicted 2080
6 SASI_Hs01_00174627 predicted 712
7 SASI_Hs01_00174628 predicted 2091
8 SASI_Hs01_00174629 predicted 2237
9 SASI_Hs01_00174630 predicted 1141
10 SASI_Hs01_00174631 predicted 2089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173045 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096896 predicted 1303
2 SASI_Rn02_00269236 predicted 2525
3 SASI_Rn01_00096899 predicted 1441
4 SASI_Rn01_00096900 predicted 2390
5 SASI_Rn02_00269237 predicted 2624
6 SASI_Rn02_00269238 predicted 2538
7 SASI_Rn02_00269239 predicted 1329
8 SASI_Rn01_00096904 predicted 750
9 SASI_Rn02_00269240 predicted 2594
10 SASI_Rn02_00269241 predicted 889
11 SASI_Rn01_00096897 predicted 1339
12 SASI_Rn01_00096898 predicted 313
13 SASI_Rn01_00096901 predicted 2065
14 SASI_Rn01_00096902 predicted 1730
15 SASI_Rn01_00096903 predicted 755
16 SASI_Rn01_00096905 predicted 2055
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028864 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146634 predicted 686
2 SASI_Mm01_00146635 predicted 1525
3 SASI_Mm02_00334537 predicted 921
4 SASI_Mm01_00146636 predicted 2772
5 SASI_Mm01_00146637 predicted 2474
6 SASI_Mm01_00146638 predicted 2615
7 SASI_Mm01_00146639 predicted 822
8 SASI_Mm01_00146640 predicted 1896
9 SASI_Mm01_00146641 predicted 1146
10 SASI_Mm01_00146642 predicted 1786
11 SASI_Mm01_00146643 predicted 838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028864
ZC3HAV1 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type, antiviral 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000181294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-712s1c1
Sequence:CCGGCGATGTTCTCTCGGAACAGAACTCGAGTTCTGTTCCGAGAGAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-2136s1c1
Sequence:CCGGGCTACATCGTAAATCCTGTATCTCGAGATACAGGATTTACGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-635s1c1
Sequence:CCGGCTGCACCTTTGCAAGCTTAATCTCGAGATTAAGCTTGCAAAGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.2-2644s1c1
Sequence:CCGGGGGATGATTCAGACGAATATACTCGAGTATATTCGTCTGAATCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028864.2-3044s21c1
Sequence:CCGGCTTTAGCTTACAGGCTATTTACTCGAGTAAATAGCCTGTAAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-2258s21c1
Sequence:CCGGACCGGTGGCAGCTGTTCATATCTCGAGATATGAACAGCTGCCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-1732s21c1
Sequence:CCGGACGGCATTCCTGCATAGTAAACTCGAGTTTACTATGCAGGAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-1797s21c1
Sequence:CCGGCCCAAATGGCTTTAGTCAAATCTCGAGATTTGACTAAAGCCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-2531s21c1
Sequence:CCGGGCCATACCAGCTCCGAAATTACTCGAGTAATTTCGGAGCTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028864
ZC3HAV1 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type, antiviral 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000181294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-712s1c1
Sequence:CCGGCGATGTTCTCTCGGAACAGAACTCGAGTTCTGTTCCGAGAGAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-2136s1c1
Sequence:CCGGGCTACATCGTAAATCCTGTATCTCGAGATACAGGATTTACGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-635s1c1
Sequence:CCGGCTGCACCTTTGCAAGCTTAATCTCGAGATTAAGCTTGCAAAGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.2-2644s1c1
Sequence:CCGGGGGATGATTCAGACGAATATACTCGAGTATATTCGTCTGAATCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028864.2-3044s21c1
Sequence:CCGGCTTTAGCTTACAGGCTATTTACTCGAGTAAATAGCCTGTAAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-2258s21c1
Sequence:CCGGACCGGTGGCAGCTGTTCATATCTCGAGATATGAACAGCTGCCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-1732s21c1
Sequence:CCGGACGGCATTCCTGCATAGTAAACTCGAGTTTACTATGCAGGAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-1797s21c1
Sequence:CCGGCCCAAATGGCTTTAGTCAAATCTCGAGATTTGACTAAAGCCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-2531s21c1
Sequence:CCGGGCCATACCAGCTCCGAAATTACTCGAGTAATTTCGGAGCTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028864
ZC3HAV1 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type, antiviral 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000181294    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-712s1c1
Sequence:CCGGCGATGTTCTCTCGGAACAGAACTCGAGTTCTGTTCCGAGAGAACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-2136s1c1
Sequence:CCGGGCTACATCGTAAATCCTGTATCTCGAGATACAGGATTTACGATGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198039    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.1-635s1c1
Sequence:CCGGCTGCACCTTTGCAAGCTTAATCTCGAGATTAAGCTTGCAAAGGTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028864.2-2644s1c1
Sequence:CCGGGGGATGATTCAGACGAATATACTCGAGTATATTCGTCTGAATCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243456    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028864.2-3044s21c1
Sequence:CCGGCTTTAGCTTACAGGCTATTTACTCGAGTAAATAGCCTGTAAGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-2258s21c1
Sequence:CCGGACCGGTGGCAGCTGTTCATATCTCGAGATATGAACAGCTGCCACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-1732s21c1
Sequence:CCGGACGGCATTCCTGCATAGTAAACTCGAGTTTACTATGCAGGAATGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-1797s21c1
Sequence:CCGGCCCAAATGGCTTTAGTCAAATCTCGAGATTTGACTAAAGCCATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028864.2-2531s21c1
Sequence:CCGGGCCATACCAGCTCCGAAATTACTCGAGTAATTTCGGAGCTGGTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020119
VALIDATED
ZC3HAV1 MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type, antiviral 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020119.x-2758s1c1
Sequence:CCGGCCGTGCCTATGTGGAATCTATCTCGAGATAGATTCCACATAGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020119.x-3755s1c1
Sequence:CCGGGCAACCTTTCTCTCCTGTCTACTCGAGTAGACAGGAGAGAAAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-2587s1c1
Sequence:CCGGCCATCACCTACATCCAGAATACTCGAGTATTCTGGATGTAGGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-1740s1c1
Sequence:CCGGGCAGCGGTCACAGAGAAATATCTCGAGATATTTCTCTGTGACCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-1142s1c1
Sequence:CCGGCGGTTCTTTCAGGGCAGCCAACTCGAGTTGGCTGCCCTGAAAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-3089s21c1
Sequence:CCGGATTAGTTAGAACCGATGAATACTCGAGTATTCATCGGTTCTAACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-1941s21c1
Sequence:CCGGGTAAGGGTTGTCCGCTTAATGCTCGAGCATTAAGCGGACAACCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-1995s21c1
Sequence:CCGGACCGGTGGCAGATGCTTATTGCTCGAGCAATAAGCATCTGCCACCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020119
VALIDATED
ZC3HAV1 MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type, antiviral 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020119.x-2758s1c1
Sequence:CCGGCCGTGCCTATGTGGAATCTATCTCGAGATAGATTCCACATAGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020119.x-3755s1c1
Sequence:CCGGGCAACCTTTCTCTCCTGTCTACTCGAGTAGACAGGAGAGAAAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-2587s1c1
Sequence:CCGGCCATCACCTACATCCAGAATACTCGAGTATTCTGGATGTAGGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-1740s1c1
Sequence:CCGGGCAGCGGTCACAGAGAAATATCTCGAGATATTTCTCTGTGACCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-1142s1c1
Sequence:CCGGCGGTTCTTTCAGGGCAGCCAACTCGAGTTGGCTGCCCTGAAAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-3089s21c1
Sequence:CCGGATTAGTTAGAACCGATGAATACTCGAGTATTCATCGGTTCTAACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-1941s21c1
Sequence:CCGGGTAAGGGTTGTCCGCTTAATGCTCGAGCATTAAGCGGACAACCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-1995s21c1
Sequence:CCGGACCGGTGGCAGATGCTTATTGCTCGAGCAATAAGCATCTGCCACCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020119
VALIDATED
ZC3HAV1 MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type, antiviral 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020119.x-2758s1c1
Sequence:CCGGCCGTGCCTATGTGGAATCTATCTCGAGATAGATTCCACATAGGCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004517    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020119.x-3755s1c1
Sequence:CCGGGCAACCTTTCTCTCCTGTCTACTCGAGTAGACAGGAGAGAAAGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-2587s1c1
Sequence:CCGGCCATCACCTACATCCAGAATACTCGAGTATTCTGGATGTAGGTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-1740s1c1
Sequence:CCGGGCAGCGGTCACAGAGAAATATCTCGAGATATTTCTCTGTGACCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_020119.x-1142s1c1
Sequence:CCGGCGGTTCTTTCAGGGCAGCCAACTCGAGTTGGCTGCCCTGAAAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-3089s21c1
Sequence:CCGGATTAGTTAGAACCGATGAATACTCGAGTATTCATCGGTTCTAACTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-1941s21c1
Sequence:CCGGGTAAGGGTTGTCCGCTTAATGCTCGAGCATTAAGCGGACAACCCTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020119.3-1995s21c1
Sequence:CCGGACCGGTGGCAGATGCTTATTGCTCGAGCAATAAGCATCTGCCACCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks