EMAIL THIS PAGE TO A FRIEND

ZC3HAV1L

zinc finger CCCH-type, antiviral 1-like

Synonyms: C7orf39
UniProtKB ID: Q96H79, Q8WUD9
Gene ID:
Mouse(209032) zinc finger CCCH-type, antiviral 1-like
Rat(362341) zinc finger CCCH-type, antiviral 1-like
cow(523239) zinc finger CCCH-type, antiviral 1-like
sheep(101109793) zinc finger CCCH-type, antiviral 1-like
domestic guinea pig(100720272) zinc finger CCCH-type, antiviral 1-like
naked mole-rat(101720430) zinc finger CCCH-type, antiviral 1-like
chicken(418108) zinc finger CCCH-type, antiviral 1-like
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080660 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080660 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080660 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU017951 MISSION® esiRNA esiRNA targeting mouse Zc3hav1l (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080660 Rosetta Predictions human pricing
XM_001069306 Rosetta Predictions rat pricing
XM_342661 Rosetta Predictions rat pricing
NM_172467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080660 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144979 predicted 500
2 SASI_Hs01_00144980 predicted 680
3 SASI_Hs01_00144981 predicted 577
4 SASI_Hs01_00144982 predicted 410
5 SASI_Hs01_00144983 predicted 367
6 SASI_Hs01_00144984 predicted 644
7 SASI_Hs01_00144985 predicted 730
8 SASI_Hs02_00362420 predicted 895
9 SASI_Hs01_00144986 predicted 620
10 SASI_Hs02_00362421 predicted 514
11 SASI_Hs01_00144987 predicted 667
12 SASI_Hs01_00144988 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00327546 predicted 1547
2 SASI_Rn02_00327547 predicted 1578
3 SASI_Rn02_00327548 predicted 1425
4 SASI_Rn02_00327549 predicted 1522
5 SASI_Rn02_00327550 predicted 1527
6 SASI_Rn02_00327551 predicted 1474
7 SASI_Rn02_00327552 predicted 1426
8 SASI_Rn02_00327553 predicted 1586
9 SASI_Rn02_00327554 predicted 1477
10 SASI_Rn02_00327555 predicted 1578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394630 predicted 1708
2 SASI_Rn02_00394631 predicted 1734
3 SASI_Rn02_00394632 predicted 1771
4 SASI_Rn02_00394633 predicted 1529
5 SASI_Rn02_00394634 predicted 1800
6 SASI_Rn02_00394635 predicted 1580
7 SASI_Rn02_00394636 predicted 1431
8 SASI_Rn02_00394637 predicted 1754
9 SASI_Rn02_00394638 predicted 1483
10 SASI_Rn02_00394639 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139837 predicted 771
2 SASI_Mm02_00344005 predicted 542
3 SASI_Mm01_00139838 predicted 1135
4 SASI_Mm01_00139839 predicted 735
5 SASI_Mm01_00139840 predicted 423
6 SASI_Mm01_00139842 predicted 749
7 SASI_Mm01_00139843 predicted 582
8 SASI_Mm01_00139844 predicted 749
9 SASI_Mm01_00139845 predicted 1142
10 SASI_Mm01_00139846 predicted 607
11 SASI_Mm01_00139841 predicted 806
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080660
ZC3HAV1L MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type, antiviral 1-like
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080660.3-680s21c1
Sequence:CCGGAGGACCAAGGACTGAATATTCCTCGAGGAATATTCAGTCCTTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080660.3-1197s21c1
Sequence:CCGGCACTTAATATTGTCTCATAAGCTCGAGCTTATGAGACAATATTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080660.3-1229s21c1
Sequence:CCGGATTTGTTCACATCGTACATAACTCGAGTTATGTACGATGTGAACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080660.2-575s1c1
Sequence:CCGGGCAACAAGTTTCATGTGTGCACTCGAGTGCACACATGAAACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080660.2-1167s1c1
Sequence:CCGGCTAGAGTACTTTGCACTCATTCTCGAGAATGAGTGCAAAGTACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080660.2-735s1c1
Sequence:CCGGCAAGCATATAAAGCTGCACAACTCGAGTTGTGCAGCTTTATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-738s1c1
Sequence:CCGGGCATATAAAGCTGCACAAGATCTCGAGATCTTGTGCAGCTTTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-648s1c1
Sequence:CCGGGCTTATCCATGCTGCATCTTTCTCGAGAAAGATGCAGCATGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080660.2-1166s1c1
Sequence:CCGGCCTAGAGTACTTTGCACTCATCTCGAGATGAGTGCAAAGTACTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080660.2-993s1c1
Sequence:CCGGGAACAGGCAAAGAGAGGCTAACTCGAGTTAGCCTCTCTTTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-561s1c1
Sequence:CCGGCCTCAAGGATAAATGCAACAACTCGAGTTGTTGCATTTATCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080660
ZC3HAV1L MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type, antiviral 1-like
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080660.3-680s21c1
Sequence:CCGGAGGACCAAGGACTGAATATTCCTCGAGGAATATTCAGTCCTTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080660.3-1197s21c1
Sequence:CCGGCACTTAATATTGTCTCATAAGCTCGAGCTTATGAGACAATATTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080660.3-1229s21c1
Sequence:CCGGATTTGTTCACATCGTACATAACTCGAGTTATGTACGATGTGAACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080660.2-575s1c1
Sequence:CCGGGCAACAAGTTTCATGTGTGCACTCGAGTGCACACATGAAACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080660.2-1167s1c1
Sequence:CCGGCTAGAGTACTTTGCACTCATTCTCGAGAATGAGTGCAAAGTACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080660.2-735s1c1
Sequence:CCGGCAAGCATATAAAGCTGCACAACTCGAGTTGTGCAGCTTTATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-738s1c1
Sequence:CCGGGCATATAAAGCTGCACAAGATCTCGAGATCTTGTGCAGCTTTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-648s1c1
Sequence:CCGGGCTTATCCATGCTGCATCTTTCTCGAGAAAGATGCAGCATGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080660.2-1166s1c1
Sequence:CCGGCCTAGAGTACTTTGCACTCATCTCGAGATGAGTGCAAAGTACTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080660.2-993s1c1
Sequence:CCGGGAACAGGCAAAGAGAGGCTAACTCGAGTTAGCCTCTCTTTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-561s1c1
Sequence:CCGGCCTCAAGGATAAATGCAACAACTCGAGTTGTTGCATTTATCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080660
ZC3HAV1L MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type, antiviral 1-like
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080660.3-680s21c1
Sequence:CCGGAGGACCAAGGACTGAATATTCCTCGAGGAATATTCAGTCCTTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080660.3-1197s21c1
Sequence:CCGGCACTTAATATTGTCTCATAAGCTCGAGCTTATGAGACAATATTAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435282    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080660.3-1229s21c1
Sequence:CCGGATTTGTTCACATCGTACATAACTCGAGTTATGTACGATGTGAACAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149479    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080660.2-575s1c1
Sequence:CCGGGCAACAAGTTTCATGTGTGCACTCGAGTGCACACATGAAACTTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080660.2-1167s1c1
Sequence:CCGGCTAGAGTACTTTGCACTCATTCTCGAGAATGAGTGCAAAGTACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147082    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080660.2-735s1c1
Sequence:CCGGCAAGCATATAAAGCTGCACAACTCGAGTTGTGCAGCTTTATATGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-738s1c1
Sequence:CCGGGCATATAAAGCTGCACAAGATCTCGAGATCTTGTGCAGCTTTATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-648s1c1
Sequence:CCGGGCTTATCCATGCTGCATCTTTCTCGAGAAAGATGCAGCATGGATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146497    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_080660.2-1166s1c1
Sequence:CCGGCCTAGAGTACTTTGCACTCATCTCGAGATGAGTGCAAAGTACTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080660.2-993s1c1
Sequence:CCGGGAACAGGCAAAGAGAGGCTAACTCGAGTTAGCCTCTCTTTGCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080660.2-561s1c1
Sequence:CCGGCCTCAAGGATAAATGCAACAACTCGAGTTGTTGCATTTATCCTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172467
ZC3HAV1L MISSION shRNA Bacterial Glycerol Stock
zinc finger CCCH-type, antiviral 1-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.2-748s1c1
Sequence:CCGGCTCTGTCTACAGACATAAGAACTCGAGTTCTTATGTCTGTAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.2-419s1c1
Sequence:CCGGGATATCCACACACCTATCAACCTCGAGGTTGATAGGTGTGTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172467.2-1802s21c1
Sequence:CCGGTTCACTCCTTCCAGTTATATCCTCGAGGATATAACTGGAAGGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-588s21c1
Sequence:CCGGAGGATAGATGCAACAAGTTTCCTCGAGGAAACTTGTTGCATCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-404s21c1
Sequence:CCGGTGTTCTCTGTCCCATGATATCCTCGAGGATATCATGGGACAGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-728s21c1
Sequence:CCGGGTCGTGAATTTCCAGATAATCCTCGAGGATTATCTGGAAATTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-697s21c1
Sequence:CCGGGCTAGAGGACCAAGAACTTAGCTCGAGCTAAGTTCTTGGTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172467.1-1624s1c1
Sequence:CCGGCCCTCTGTGCTGTCATCAATACTCGAGTATTGATGACAGCACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.1-727s1c1
Sequence:CCGGGCGTCGTGAATTTCCAGATAACTCGAGTTATCTGGAAATTCACGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172467
ZC3HAV1L MISSION shRNA shRNA Plasmid DNA
zinc finger CCCH-type, antiviral 1-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.2-748s1c1
Sequence:CCGGCTCTGTCTACAGACATAAGAACTCGAGTTCTTATGTCTGTAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.2-419s1c1
Sequence:CCGGGATATCCACACACCTATCAACCTCGAGGTTGATAGGTGTGTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172467.2-1802s21c1
Sequence:CCGGTTCACTCCTTCCAGTTATATCCTCGAGGATATAACTGGAAGGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-588s21c1
Sequence:CCGGAGGATAGATGCAACAAGTTTCCTCGAGGAAACTTGTTGCATCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-404s21c1
Sequence:CCGGTGTTCTCTGTCCCATGATATCCTCGAGGATATCATGGGACAGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-728s21c1
Sequence:CCGGGTCGTGAATTTCCAGATAATCCTCGAGGATTATCTGGAAATTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-697s21c1
Sequence:CCGGGCTAGAGGACCAAGAACTTAGCTCGAGCTAAGTTCTTGGTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172467.1-1624s1c1
Sequence:CCGGCCCTCTGTGCTGTCATCAATACTCGAGTATTGATGACAGCACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.1-727s1c1
Sequence:CCGGGCGTCGTGAATTTCCAGATAACTCGAGTTATCTGGAAATTCACGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172467
ZC3HAV1L MISSION shRNA Lentiviral Transduction Particles
zinc finger CCCH-type, antiviral 1-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.2-748s1c1
Sequence:CCGGCTCTGTCTACAGACATAAGAACTCGAGTTCTTATGTCTGTAGACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.2-419s1c1
Sequence:CCGGGATATCCACACACCTATCAACCTCGAGGTTGATAGGTGTGTGGATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241606    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172467.2-1802s21c1
Sequence:CCGGTTCACTCCTTCCAGTTATATCCTCGAGGATATAACTGGAAGGAGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-588s21c1
Sequence:CCGGAGGATAGATGCAACAAGTTTCCTCGAGGAAACTTGTTGCATCTATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-404s21c1
Sequence:CCGGTGTTCTCTGTCCCATGATATCCTCGAGGATATCATGGGACAGAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-728s21c1
Sequence:CCGGGTCGTGAATTTCCAGATAATCCTCGAGGATTATCTGGAAATTCACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172467.2-697s21c1
Sequence:CCGGGCTAGAGGACCAAGAACTTAGCTCGAGCTAAGTTCTTGGTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184643    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172467.1-1624s1c1
Sequence:CCGGCCCTCTGTGCTGTCATCAATACTCGAGTATTGATGACAGCACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180961    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172467.1-727s1c1
Sequence:CCGGGCGTCGTGAATTTCCAGATAACTCGAGTTATCTGGAAATTCACGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks