EMAIL THIS PAGE TO A FRIEND

ZC3HC1

zinc finger, C3HC-type containing 1

Synonyms: NIPA
Gene ID:
Mouse(232679) zinc finger, C3HC type 1
Rat(296957) zinc finger, C3HC-type containing 1
Zebrafish(560141) zinc finger, C3HC-type containing 1
chicken(416679) zinc finger, C3HC-type containing 1
Horse(100057013) zinc finger, C3HC-type containing 1
domestic cat(101086548) zinc finger, C3HC-type containing 1
dog(475196) zinc finger, C3HC-type containing 1
naked mole-rat(101701762) zinc finger, C3HC-type containing 1
domestic guinea pig(100734183) zinc finger, C3HC-type containing 1
cow(533550) zinc finger, C3HC-type containing 1
sheep(101115452) zinc finger, C3HC-type containing 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172735 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172735 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172735 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016478 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016478 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016478 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016478 Rosetta Predictions human pricing
NM_001127293 Rosetta Predictions rat pricing
NM_172735 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016478 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207894 predicted 873
2 SASI_Hs01_00207895 predicted 215
3 SASI_Hs01_00207896 predicted 660
4 SASI_Hs01_00207897 predicted 226
5 SASI_Hs02_00349529 predicted 1491
6 SASI_Hs01_00207898 predicted 1480
7 SASI_Hs02_00349530 predicted 1599
8 SASI_Hs01_00207899 predicted 449
9 SASI_Hs01_00207900 predicted 1298
10 SASI_Hs02_00349531 predicted 255
11 SASI_Hs01_00207893 predicted 649
12 SASI_Hs01_00207901 predicted 305
13 SASI_Hs01_00207902 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127293 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253493 predicted 641
2 SASI_Rn02_00253494 predicted 708
3 SASI_Rn02_00253495 predicted 1477
4 SASI_Rn02_00253496 predicted 214
5 SASI_Rn02_00253497 predicted 992
6 SASI_Rn02_00253498 predicted 1331
7 SASI_Rn02_00253499 predicted 563
8 SASI_Rn02_00253500 predicted 1313
9 SASI_Rn02_00253501 predicted 1289
10 SASI_Rn02_00253502 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172735 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121381 predicted 553
2 SASI_Mm01_00121382 predicted 1507
3 SASI_Mm01_00121383 predicted 395
4 SASI_Mm01_00121384 predicted 294
5 SASI_Mm01_00121385 predicted 503
6 SASI_Mm01_00121386 predicted 1247
7 SASI_Mm01_00121387 predicted 210
8 SASI_Mm01_00121388 predicted 431
9 SASI_Mm01_00121390 predicted 544
10 SASI_Mm02_00344553 predicted 1298
11 SASI_Mm01_00121389 predicted 207
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172735
VALIDATED
ZC3HC1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, C3HC-type containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172735.1-1268s1c1
Sequence:CCGGCCACCTCTCAGCATAGAGATTCTCGAGAATCTCTATGCTGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172735.1-304s1c1
Sequence:CCGGCCACTTATCTGCGCTAAATATCTCGAGATATTTAGCGCAGATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-804s1c1
Sequence:CCGGGCTCTCCCTGATAACATGTTACTCGAGTAACATGTTATCAGGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172735.1-399s1c1
Sequence:CCGGCACGTTTGACTTTGGCAGATACTCGAGTATCTGCCAAAGTCAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-398s1c1
Sequence:CCGGCCACGTTTGACTTTGGCAGATCTCGAGATCTGCCAAAGTCAAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-169s1c1
Sequence:CCGGGCCACATTCCAGTCAGTTGATCTCGAGATCAACTGACTGGAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216040    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172735.2-1506s1c1
Sequence:CCGGCAAGGAAAGTGTTCCGAATATCTCGAGATATTCGGAACACTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172735.2-226s1c1
Sequence:CCGGCAAGCAAAGAAGCCTTCTTTCCTCGAGGAAAGAAGGCTTCTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172735
VALIDATED
ZC3HC1 MISSION shRNA shRNA Plasmid DNA
zinc finger, C3HC-type containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172735.1-1268s1c1
Sequence:CCGGCCACCTCTCAGCATAGAGATTCTCGAGAATCTCTATGCTGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172735.1-304s1c1
Sequence:CCGGCCACTTATCTGCGCTAAATATCTCGAGATATTTAGCGCAGATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-804s1c1
Sequence:CCGGGCTCTCCCTGATAACATGTTACTCGAGTAACATGTTATCAGGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172735.1-399s1c1
Sequence:CCGGCACGTTTGACTTTGGCAGATACTCGAGTATCTGCCAAAGTCAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-398s1c1
Sequence:CCGGCCACGTTTGACTTTGGCAGATCTCGAGATCTGCCAAAGTCAAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-169s1c1
Sequence:CCGGGCCACATTCCAGTCAGTTGATCTCGAGATCAACTGACTGGAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216040    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172735.2-1506s1c1
Sequence:CCGGCAAGGAAAGTGTTCCGAATATCTCGAGATATTCGGAACACTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172735.2-226s1c1
Sequence:CCGGCAAGCAAAGAAGCCTTCTTTCCTCGAGGAAAGAAGGCTTCTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172735
VALIDATED
ZC3HC1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, C3HC-type containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172735.1-1268s1c1
Sequence:CCGGCCACCTCTCAGCATAGAGATTCTCGAGAATCTCTATGCTGAGAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172735.1-304s1c1
Sequence:CCGGCCACTTATCTGCGCTAAATATCTCGAGATATTTAGCGCAGATAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-804s1c1
Sequence:CCGGGCTCTCCCTGATAACATGTTACTCGAGTAACATGTTATCAGGGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181074    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172735.1-399s1c1
Sequence:CCGGCACGTTTGACTTTGGCAGATACTCGAGTATCTGCCAAAGTCAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-398s1c1
Sequence:CCGGCCACGTTTGACTTTGGCAGATCTCGAGATCTGCCAAAGTCAAACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172735.1-169s1c1
Sequence:CCGGGCCACATTCCAGTCAGTTGATCTCGAGATCAACTGACTGGAATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216040    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172735.2-1506s1c1
Sequence:CCGGCAAGGAAAGTGTTCCGAATATCTCGAGATATTCGGAACACTTTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216998    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172735.2-226s1c1
Sequence:CCGGCAAGCAAAGAAGCCTTCTTTCCTCGAGGAAAGAAGGCTTCTTTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016478
VALIDATED
ZC3HC1 MISSION shRNA Bacterial Glycerol Stock
zinc finger, C3HC-type containing 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-248s1c1
Sequence:CCGGCGGAACAACCTTCATTGGAATCTCGAGATTCCAATGAAGGTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-1498s1c1
Sequence:CCGGCTCTCTGAGAAATCAAGGAAACTCGAGTTTCCTTGATTTCTCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016478.2-906s1c1
Sequence:CCGGCCAGCAGATTGAATCGTCCATCTCGAGATGGACGATTCAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-578s1c1
Sequence:CCGGCTGCTATTCTTGTTAGTGAATCTCGAGATTCACTAACAAGAATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-1342s1c1
Sequence:CCGGCCTTGGGTGAATATCACACTTCTCGAGAAGTGTGATATTCACCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1674s21c1
Sequence:CCGGAGGCAGTGAGTGTCAACTATCCTCGAGGATAGTTGACACTCACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016478.3-421s21c1
Sequence:CCGGTTTGACTTTGACAGATATAAGCTCGAGCTTATATCTGTCAAAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1607s21c1
Sequence:CCGGTTTCGGTCAGCTGACACTAAGCTCGAGCTTAGTGTCAGCTGACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1307s21c1
Sequence:CCGGACTGGTGCCCTTGGGTGAATACTCGAGTATTCACCCAAGGGCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-757s21c1
Sequence:CCGGGTCCACGTCACTGCCTGTATTCTCGAGAATACAGGCAGTGACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1484s21c1
Sequence:CCGGCAAGGAAAGTATTCCGAATATCTCGAGATATTCGGAATACTTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016478
VALIDATED
ZC3HC1 MISSION shRNA shRNA Plasmid DNA
zinc finger, C3HC-type containing 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-248s1c1
Sequence:CCGGCGGAACAACCTTCATTGGAATCTCGAGATTCCAATGAAGGTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-1498s1c1
Sequence:CCGGCTCTCTGAGAAATCAAGGAAACTCGAGTTTCCTTGATTTCTCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016478.2-906s1c1
Sequence:CCGGCCAGCAGATTGAATCGTCCATCTCGAGATGGACGATTCAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-578s1c1
Sequence:CCGGCTGCTATTCTTGTTAGTGAATCTCGAGATTCACTAACAAGAATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-1342s1c1
Sequence:CCGGCCTTGGGTGAATATCACACTTCTCGAGAAGTGTGATATTCACCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1674s21c1
Sequence:CCGGAGGCAGTGAGTGTCAACTATCCTCGAGGATAGTTGACACTCACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016478.3-421s21c1
Sequence:CCGGTTTGACTTTGACAGATATAAGCTCGAGCTTATATCTGTCAAAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1607s21c1
Sequence:CCGGTTTCGGTCAGCTGACACTAAGCTCGAGCTTAGTGTCAGCTGACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1307s21c1
Sequence:CCGGACTGGTGCCCTTGGGTGAATACTCGAGTATTCACCCAAGGGCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-757s21c1
Sequence:CCGGGTCCACGTCACTGCCTGTATTCTCGAGAATACAGGCAGTGACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1484s21c1
Sequence:CCGGCAAGGAAAGTATTCCGAATATCTCGAGATATTCGGAATACTTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016478
VALIDATED
ZC3HC1 MISSION shRNA Lentiviral Transduction Particles
zinc finger, C3HC-type containing 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-248s1c1
Sequence:CCGGCGGAACAACCTTCATTGGAATCTCGAGATTCCAATGAAGGTTGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037541    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-1498s1c1
Sequence:CCGGCTCTCTGAGAAATCAAGGAAACTCGAGTTTCCTTGATTTCTCAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016478.2-906s1c1
Sequence:CCGGCCAGCAGATTGAATCGTCCATCTCGAGATGGACGATTCAATCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-578s1c1
Sequence:CCGGCTGCTATTCTTGTTAGTGAATCTCGAGATTCACTAACAAGAATAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_016478.2-1342s1c1
Sequence:CCGGCCTTGGGTGAATATCACACTTCTCGAGAAGTGTGATATTCACCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377427    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1674s21c1
Sequence:CCGGAGGCAGTGAGTGTCAACTATCCTCGAGGATAGTTGACACTCACTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016478.3-421s21c1
Sequence:CCGGTTTGACTTTGACAGATATAAGCTCGAGCTTATATCTGTCAAAGTCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1607s21c1
Sequence:CCGGTTTCGGTCAGCTGACACTAAGCTCGAGCTTAGTGTCAGCTGACCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1307s21c1
Sequence:CCGGACTGGTGCCCTTGGGTGAATACTCGAGTATTCACCCAAGGGCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-757s21c1
Sequence:CCGGGTCCACGTCACTGCCTGTATTCTCGAGAATACAGGCAGTGACGTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_016478.3-1484s21c1
Sequence:CCGGCAAGGAAAGTATTCCGAATATCTCGAGATATTCGGAATACTTTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks