EMAIL THIS PAGE TO A FRIEND

ZC4H2

zinc finger, C4H2 domain containing

Synonyms: HCA127 KIAA1166 WRWF WWS
Gene ID:
Human(55906) Summary: This gene encodes a member of the zinc finger domain-containing protein family. This family member has a C-terminal zinc finger domain that is characterized by four cysteine residues and two histidine residues, and it also includes a coiled-coil region. This protein has been detected as an autoantigen in hepatocellular carcinoma patients. This gene has been identified as a potential candidate for X-linked mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(245522) zinc finger, C4H2 domain containing
Rat(367838) zinc finger, C4H2 domain containing
Zebrafish(323487) zinc finger, C4H2 domain containing
chicken(422176) zinc finger, C4H2 domain containing
dog(491920) zinc finger C4H2 domain-containing protein-like
domestic cat(101101621) zinc finger, C4H2 domain containing
cow(768236) zinc finger, C4H2 domain containing
sheep(101111604) zinc finger, C4H2 domain containing
domestic guinea pig(100734959) zinc finger, C4H2 domain containing
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018684 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018684 Rosetta Predictions human pricing
NM_001126374 Rosetta Predictions rat pricing
NM_001003916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073070 predicted 861
2 SASI_Hs01_00073071 predicted 813
3 SASI_Hs01_00073072 predicted 1047
4 SASI_Hs01_00073073 predicted 852
5 SASI_Hs01_00073074 predicted 292
6 SASI_Hs01_00073075 predicted 779
7 SASI_Hs01_00073076 predicted 685
8 SASI_Hs01_00073077 predicted 1019
9 SASI_Hs01_00073078 predicted 1054
10 SASI_Hs01_00073079 predicted 281
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126374 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253443 predicted 312
2 SASI_Rn02_00253444 predicted 1245
3 SASI_Rn02_00253445 predicted 1176
4 SASI_Rn02_00253446 predicted 1118
5 SASI_Rn02_00253447 predicted 1176
6 SASI_Rn02_00253448 predicted 309
7 SASI_Rn02_00253449 predicted 1132
8 SASI_Rn02_00253450 predicted 463
9 SASI_Rn02_00253451 predicted 1273
10 SASI_Rn02_00253452 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00286358 predicted 1191
2 SASI_Mm01_00187328 predicted 1130
3 SASI_Mm01_00187329 predicted 1256
4 SASI_Mm01_00187331 predicted 1185
5 SASI_Mm01_00187332 predicted 1262
6 SASI_Mm01_00187333 predicted 301
7 SASI_Mm01_00187334 predicted 325
8 SASI_Mm01_00187335 predicted 319
9 SASI_Mm01_00187337 predicted 336
10 SASI_Mm02_00286359 predicted 1092
11 SASI_Mm01_00187330 predicted 1289
12 SASI_Mm01_00187336 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018684
VALIDATED
ZC4H2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, C4H2 domain containing
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-675s21c1
Sequence:CCGGTTCACCGGAATGCACCTATATCTCGAGATATAGGTGCATTCCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-373s21c1
Sequence:CCGGGAGGCTGCATGATGAGTATAACTCGAGTTATACTCATCATGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018684.1-1125s21c1
Sequence:CCGGGCCCATATCTTGTTTCAGGTACTCGAGTACCTGAAACAAGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-857s21c1
Sequence:CCGGCCACGAAGTCTCCTATTTAATCTCGAGATTAAATAGGAGACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-331s21c1
Sequence:CCGGACAATCTGAGAATGACCTAAACTCGAGTTTAGGTCATTCTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018684.1-665s1c1
Sequence:CCGGCACCAGCAAATTCACCGGAATCTCGAGATTCCGGTGAATTTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-741s1c1
Sequence:CCGGCGAAACGGAAGCAGGATGAATCTCGAGATTCATCCTGCTTCCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-1125s1c1
Sequence:CCGGGCCCATATCTTGTTTCAGGTACTCGAGTACCTGAAACAAGATATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-857s1c1
Sequence:CCGGCCACGAAGTCTCCTATTTAATCTCGAGATTAAATAGGAGACTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-217s1c1
Sequence:CCGGGCACCTGAAGGAATACAAGCACTCGAGTGCTTGTATTCCTTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-299s1c1
Sequence:CCGGGCTGACATCAATGTGATGGAACTCGAGTTCCATCACATTGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018684.1-298s1c1
Sequence:CCGGCGCTGACATCAATGTGATGGACTCGAGTCCATCACATTGATGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018684
VALIDATED
ZC4H2 MISSION shRNA shRNA Plasmid DNA
zinc finger, C4H2 domain containing
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-675s21c1
Sequence:CCGGTTCACCGGAATGCACCTATATCTCGAGATATAGGTGCATTCCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-373s21c1
Sequence:CCGGGAGGCTGCATGATGAGTATAACTCGAGTTATACTCATCATGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018684.1-1125s21c1
Sequence:CCGGGCCCATATCTTGTTTCAGGTACTCGAGTACCTGAAACAAGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-857s21c1
Sequence:CCGGCCACGAAGTCTCCTATTTAATCTCGAGATTAAATAGGAGACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-331s21c1
Sequence:CCGGACAATCTGAGAATGACCTAAACTCGAGTTTAGGTCATTCTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018684.1-665s1c1
Sequence:CCGGCACCAGCAAATTCACCGGAATCTCGAGATTCCGGTGAATTTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-741s1c1
Sequence:CCGGCGAAACGGAAGCAGGATGAATCTCGAGATTCATCCTGCTTCCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-1125s1c1
Sequence:CCGGGCCCATATCTTGTTTCAGGTACTCGAGTACCTGAAACAAGATATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-857s1c1
Sequence:CCGGCCACGAAGTCTCCTATTTAATCTCGAGATTAAATAGGAGACTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-217s1c1
Sequence:CCGGGCACCTGAAGGAATACAAGCACTCGAGTGCTTGTATTCCTTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-299s1c1
Sequence:CCGGGCTGACATCAATGTGATGGAACTCGAGTTCCATCACATTGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018684.1-298s1c1
Sequence:CCGGCGCTGACATCAATGTGATGGACTCGAGTCCATCACATTGATGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018684
VALIDATED
ZC4H2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, C4H2 domain containing
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-675s21c1
Sequence:CCGGTTCACCGGAATGCACCTATATCTCGAGATATAGGTGCATTCCGGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-373s21c1
Sequence:CCGGGAGGCTGCATGATGAGTATAACTCGAGTTATACTCATCATGCAGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275028    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018684.1-1125s21c1
Sequence:CCGGGCCCATATCTTGTTTCAGGTACTCGAGTACCTGAAACAAGATATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274961    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-857s21c1
Sequence:CCGGCCACGAAGTCTCCTATTTAATCTCGAGATTAAATAGGAGACTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018684.1-331s21c1
Sequence:CCGGACAATCTGAGAATGACCTAAACTCGAGTTTAGGTCATTCTCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130921    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018684.1-665s1c1
Sequence:CCGGCACCAGCAAATTCACCGGAATCTCGAGATTCCGGTGAATTTGCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-741s1c1
Sequence:CCGGCGAAACGGAAGCAGGATGAATCTCGAGATTCATCCTGCTTCCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128001    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-1125s1c1
Sequence:CCGGGCCCATATCTTGTTTCAGGTACTCGAGTACCTGAAACAAGATATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-857s1c1
Sequence:CCGGCCACGAAGTCTCCTATTTAATCTCGAGATTAAATAGGAGACTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-217s1c1
Sequence:CCGGGCACCTGAAGGAATACAAGCACTCGAGTGCTTGTATTCCTTCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018684.1-299s1c1
Sequence:CCGGGCTGACATCAATGTGATGGAACTCGAGTTCCATCACATTGATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130928    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018684.1-298s1c1
Sequence:CCGGCGCTGACATCAATGTGATGGACTCGAGTCCATCACATTGATGTCAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003916
ZC4H2 MISSION shRNA Bacterial Glycerol Stock
zinc finger, C4H2 domain containing
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000202189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003916.1-326s1c1
Sequence:CCGGCCGACTCATCCATGCTGATATCTCGAGATATCAGCATGGATGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003916.1-1092s1c1
Sequence:CCGGGCCCTAGTTGATACTTTCTTTCTCGAGAAAGAAAGTATCAACTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003916.1-705s1c1
Sequence:CCGGCACCAACAGATTCATCGAAATCTCGAGATTTCGATGAATCTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003916
ZC4H2 MISSION shRNA shRNA Plasmid DNA
zinc finger, C4H2 domain containing
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000202189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003916.1-326s1c1
Sequence:CCGGCCGACTCATCCATGCTGATATCTCGAGATATCAGCATGGATGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003916.1-1092s1c1
Sequence:CCGGGCCCTAGTTGATACTTTCTTTCTCGAGAAAGAAAGTATCAACTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003916.1-705s1c1
Sequence:CCGGCACCAACAGATTCATCGAAATCTCGAGATTTCGATGAATCTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003916
ZC4H2 MISSION shRNA Lentiviral Transduction Particles
zinc finger, C4H2 domain containing
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000202189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003916.1-326s1c1
Sequence:CCGGCCGACTCATCCATGCTGATATCTCGAGATATCAGCATGGATGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191956    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003916.1-1092s1c1
Sequence:CCGGGCCCTAGTTGATACTTTCTTTCTCGAGAAAGAAAGTATCAACTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003916.1-705s1c1
Sequence:CCGGCACCAACAGATTCATCGAAATCTCGAGATTTCGATGAATCTGTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks