EMAIL THIS PAGE TO A FRIEND

ZCCHC10

zinc finger, CCHC domain containing 10

UniProtKB ID: Q8TBK6, Q9NXR4
Gene ID:
Mouse(67966) zinc finger, CCHC domain containing 10
Rat(360524) zinc finger, CCHC domain containing 10
Zebrafish(334240) zinc finger, CCHC domain containing 10
dog(474679) zinc finger, CCHC domain containing 10
domestic cat(101097540) zinc finger, CCHC domain containing 10
chicken(416338) zinc finger, CCHC domain containing 10
domestic guinea pig(101787511) zinc finger, CCHC domain containing 10
naked mole-rat(101711579) zinc finger, CCHC domain containing 10
cow(515542) zinc finger, CCHC domain containing 10
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026479 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026479 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026479 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017665 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017665 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017665 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113421 MISSION® esiRNA esiRNA human ZCCHC10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017665 Rosetta Predictions human pricing
XM_001073035 Rosetta Predictions rat pricing
XM_001073063 Rosetta Predictions rat pricing
XM_001073182 Rosetta Predictions rat pricing
XM_346887 Rosetta Predictions rat pricing
NM_026479 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198229 predicted 193
2 SASI_Hs01_00198230 predicted 151
3 SASI_Hs01_00198231 predicted 252
4 SASI_Hs01_00198232 predicted 59
5 SASI_Hs01_00198233 predicted 574
6 SASI_Hs02_00350388 predicted 603
7 SASI_Hs01_00198234 predicted 133
8 SASI_Hs01_00198235 predicted 84
9 SASI_Hs01_00198236 predicted 286
10 SASI_Hs02_00350389 predicted 98
11 SASI_Hs01_00198237 predicted 81
12 SASI_Hs01_00198238 predicted 212
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341327 predicted 566
2 SASI_Rn02_00341328 predicted 510
3 SASI_Rn02_00341329 predicted 488
4 SASI_Rn02_00341330 predicted 469
5 SASI_Rn02_00341331 predicted 536
6 SASI_Rn02_00341332 predicted 219
7 SASI_Rn02_00341333 predicted 203
8 SASI_Rn02_00341334 predicted 521
9 SASI_Rn02_00341335 predicted 507
10 SASI_Rn02_00341336 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073063 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341394 predicted 647
2 SASI_Rn02_00341395 predicted 639
3 SASI_Rn02_00341396 predicted 641
4 SASI_Rn02_00341397 predicted 633
5 SASI_Rn02_00341398 predicted 632
6 SASI_Rn02_00341399 predicted 627
7 SASI_Rn02_00341400 predicted 636
8 SASI_Rn02_00341401 predicted 635
9 SASI_Rn02_00341402 predicted 650
10 SASI_Rn02_00341403 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073182 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341824 predicted 644
2 SASI_Rn02_00341825 predicted 633
3 SASI_Rn02_00341826 predicted 639
4 SASI_Rn02_00341827 predicted 640
5 SASI_Rn02_00341828 predicted 634
6 SASI_Rn02_00341829 predicted 623
7 SASI_Rn02_00341830 predicted 630
8 SASI_Rn02_00341831 predicted 628
9 SASI_Rn02_00341832 predicted 646
10 SASI_Rn02_00341833 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_346887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399404 predicted 569
2 SASI_Rn02_00399405 predicted 514
3 SASI_Rn02_00399406 predicted 481
4 SASI_Rn02_00399407 predicted 475
5 SASI_Rn02_00399408 predicted 532
6 SASI_Rn02_00399409 predicted 218
7 SASI_Rn02_00399410 predicted 209
8 SASI_Rn02_00399411 predicted 515
9 SASI_Rn02_00399412 predicted 511
10 SASI_Rn02_00399413 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026479 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330344 predicted 75
2 SASI_Mm02_00330345 predicted 55
3 SASI_Mm01_00038988 predicted 256
4 SASI_Mm01_00038989 predicted 93
5 SASI_Mm02_00330346 predicted 100
6 SASI_Mm01_00038991 predicted 193
7 SASI_Mm01_00038992 predicted 847
8 SASI_Mm01_00038994 predicted 86
9 SASI_Mm02_00330347 predicted 324
10 SASI_Mm01_00038997 predicted 239
11 SASI_Mm01_00038990 predicted 76
12 SASI_Mm01_00038993 predicted 861
13 SASI_Mm01_00038995 predicted 660
14 SASI_Mm01_00038996 predicted 670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026479
VALIDATED
ZCCHC10 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 10
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-306s1c1
Sequence:CCGGCCAGTGAGTCTTCATCAGAGACTCGAGTCTCTGATGAAGACTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-104s1c1
Sequence:CCGGCATTGGACTTATGAATGCAAACTCGAGTTTGCATTCATAAGTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026479.2-1006s1c1
Sequence:CCGGGCCTTTGAAATGAATGCTTTACTCGAGTAAAGCATTCATTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-53s1c1
Sequence:CCGGGCTGAAGCCAATAAGCAACATCTCGAGATGTTGCTTATTGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-90s1c1
Sequence:CCGGGCTTGGAATTTGGACATTGGACTCGAGTCCAATGTCCAAATTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-282s1c1
Sequence:CCGGGTACCTCTAGCAGTGACAGTTCTCGAGAACTGTCACTGCTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-633s1c1
Sequence:CCGGCGGCCAGAAGTGTTAAATAAACTCGAGTTTATTTAACACTTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-60s1c1
Sequence:CCGGCCAATAAGCAACATGTAAGATCTCGAGATCTTACATGTTGCTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-132s1c1
Sequence:CCGGGAAAGTACCTACACAGACCTTCTCGAGAAGGTCTGTGTAGGTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-45s1c1
Sequence:CCGGGAAGGAAAGCTGAAGCCAATACTCGAGTATTGGCTTCAGCTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-315s1c1
Sequence:CCGGCTTCATCAGAGAGTGAGACATCTCGAGATGTCTCACTCTCTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-515s1c1
Sequence:CCGGGATGAGCCACAGAAGAAGAAACTCGAGTTTCTTCTTCTGTGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026479.4-632s21c1
Sequence:CCGGCGGCCAGAAGTGTTAAATAAACTCGAGTTTATTTAACACTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-314s21c1
Sequence:CCGGCTTCATCAGAGAGTGAGACATCTCGAGATGTCTCACTCTCTGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-131s21c1
Sequence:CCGGGAAAGTACCTACACAGACCTTCTCGAGAAGGTCTGTGTAGGTACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-281s21c1
Sequence:CCGGGTACCTCTAGCAGTGACAGTTCTCGAGAACTGTCACTGCTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026479
VALIDATED
ZCCHC10 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 10
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-306s1c1
Sequence:CCGGCCAGTGAGTCTTCATCAGAGACTCGAGTCTCTGATGAAGACTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-104s1c1
Sequence:CCGGCATTGGACTTATGAATGCAAACTCGAGTTTGCATTCATAAGTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026479.2-1006s1c1
Sequence:CCGGGCCTTTGAAATGAATGCTTTACTCGAGTAAAGCATTCATTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-53s1c1
Sequence:CCGGGCTGAAGCCAATAAGCAACATCTCGAGATGTTGCTTATTGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-90s1c1
Sequence:CCGGGCTTGGAATTTGGACATTGGACTCGAGTCCAATGTCCAAATTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-282s1c1
Sequence:CCGGGTACCTCTAGCAGTGACAGTTCTCGAGAACTGTCACTGCTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-633s1c1
Sequence:CCGGCGGCCAGAAGTGTTAAATAAACTCGAGTTTATTTAACACTTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-60s1c1
Sequence:CCGGCCAATAAGCAACATGTAAGATCTCGAGATCTTACATGTTGCTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-132s1c1
Sequence:CCGGGAAAGTACCTACACAGACCTTCTCGAGAAGGTCTGTGTAGGTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-45s1c1
Sequence:CCGGGAAGGAAAGCTGAAGCCAATACTCGAGTATTGGCTTCAGCTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-315s1c1
Sequence:CCGGCTTCATCAGAGAGTGAGACATCTCGAGATGTCTCACTCTCTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-515s1c1
Sequence:CCGGGATGAGCCACAGAAGAAGAAACTCGAGTTTCTTCTTCTGTGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026479.4-632s21c1
Sequence:CCGGCGGCCAGAAGTGTTAAATAAACTCGAGTTTATTTAACACTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-314s21c1
Sequence:CCGGCTTCATCAGAGAGTGAGACATCTCGAGATGTCTCACTCTCTGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-131s21c1
Sequence:CCGGGAAAGTACCTACACAGACCTTCTCGAGAAGGTCTGTGTAGGTACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-281s21c1
Sequence:CCGGGTACCTCTAGCAGTGACAGTTCTCGAGAACTGTCACTGCTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026479
VALIDATED
ZCCHC10 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 10
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200128    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-306s1c1
Sequence:CCGGCCAGTGAGTCTTCATCAGAGACTCGAGTCTCTGATGAAGACTCACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-104s1c1
Sequence:CCGGCATTGGACTTATGAATGCAAACTCGAGTTTGCATTCATAAGTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026479.2-1006s1c1
Sequence:CCGGGCCTTTGAAATGAATGCTTTACTCGAGTAAAGCATTCATTTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198994    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-53s1c1
Sequence:CCGGGCTGAAGCCAATAAGCAACATCTCGAGATGTTGCTTATTGGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-90s1c1
Sequence:CCGGGCTTGGAATTTGGACATTGGACTCGAGTCCAATGTCCAAATTCCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-282s1c1
Sequence:CCGGGTACCTCTAGCAGTGACAGTTCTCGAGAACTGTCACTGCTAGAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177890    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-633s1c1
Sequence:CCGGCGGCCAGAAGTGTTAAATAAACTCGAGTTTATTTAACACTTCTGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-60s1c1
Sequence:CCGGCCAATAAGCAACATGTAAGATCTCGAGATCTTACATGTTGCTTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-132s1c1
Sequence:CCGGGAAAGTACCTACACAGACCTTCTCGAGAAGGTCTGTGTAGGTACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-45s1c1
Sequence:CCGGGAAGGAAAGCTGAAGCCAATACTCGAGTATTGGCTTCAGCTTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026479.2-315s1c1
Sequence:CCGGCTTCATCAGAGAGTGAGACATCTCGAGATGTCTCACTCTCTGATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026479.2-515s1c1
Sequence:CCGGGATGAGCCACAGAAGAAGAAACTCGAGTTTCTTCTTCTGTGGCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026479.4-632s21c1
Sequence:CCGGCGGCCAGAAGTGTTAAATAAACTCGAGTTTATTTAACACTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-314s21c1
Sequence:CCGGCTTCATCAGAGAGTGAGACATCTCGAGATGTCTCACTCTCTGATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-131s21c1
Sequence:CCGGGAAAGTACCTACACAGACCTTCTCGAGAAGGTCTGTGTAGGTACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026479.4-281s21c1
Sequence:CCGGGTACCTCTAGCAGTGACAGTTCTCGAGAACTGTCACTGCTAGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017665
ZCCHC10 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017665.1-227s1c1
Sequence:CCGGCAATGTAGAAAGAAAGGCCAACTCGAGTTGGCCTTTCTTTCTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-319s1c1
Sequence:CCGGCAGAGAGTGAAGAAACATCTACTCGAGTAGATGTTTCTTCACTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017665.1-894s1c1
Sequence:CCGGGCAGTGGATTTCTAATGCTTTCTCGAGAAAGCATTAGAAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-65s1c1
Sequence:CCGGGCAACATGTAAGATGTCAGAACTCGAGTTCTGACATCTTACATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-54s1c1
Sequence:CCGGGAAGCGAATAAGCAACATGTACTCGAGTACATGTTGCTTATTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-65s21c2
Sequence:CCGGGCAACATGTAAGATGTCAGAACTCGAGTTCTGACATCTTACATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017665.1-894s21c1
Sequence:CCGGGCAGTGGATTTCTAATGCTTTCTCGAGAAAGCATTAGAAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-319s21c1
Sequence:CCGGCAGAGAGTGAAGAAACATCTACTCGAGTAGATGTTTCTTCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-54s21c1
Sequence:CCGGGAAGCGAATAAGCAACATGTACTCGAGTACATGTTGCTTATTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017665
ZCCHC10 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017665.1-227s1c1
Sequence:CCGGCAATGTAGAAAGAAAGGCCAACTCGAGTTGGCCTTTCTTTCTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-319s1c1
Sequence:CCGGCAGAGAGTGAAGAAACATCTACTCGAGTAGATGTTTCTTCACTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017665.1-894s1c1
Sequence:CCGGGCAGTGGATTTCTAATGCTTTCTCGAGAAAGCATTAGAAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-65s1c1
Sequence:CCGGGCAACATGTAAGATGTCAGAACTCGAGTTCTGACATCTTACATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-54s1c1
Sequence:CCGGGAAGCGAATAAGCAACATGTACTCGAGTACATGTTGCTTATTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-65s21c2
Sequence:CCGGGCAACATGTAAGATGTCAGAACTCGAGTTCTGACATCTTACATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017665.1-894s21c1
Sequence:CCGGGCAGTGGATTTCTAATGCTTTCTCGAGAAAGCATTAGAAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-319s21c1
Sequence:CCGGCAGAGAGTGAAGAAACATCTACTCGAGTAGATGTTTCTTCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-54s21c1
Sequence:CCGGGAAGCGAATAAGCAACATGTACTCGAGTACATGTTGCTTATTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017665
ZCCHC10 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166879    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017665.1-227s1c1
Sequence:CCGGCAATGTAGAAAGAAAGGCCAACTCGAGTTGGCCTTTCTTTCTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134841    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-319s1c1
Sequence:CCGGCAGAGAGTGAAGAAACATCTACTCGAGTAGATGTTTCTTCACTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017665.1-894s1c1
Sequence:CCGGGCAGTGGATTTCTAATGCTTTCTCGAGAAAGCATTAGAAATCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-65s1c1
Sequence:CCGGGCAACATGTAAGATGTCAGAACTCGAGTTCTGACATCTTACATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017665.1-54s1c1
Sequence:CCGGGAAGCGAATAAGCAACATGTACTCGAGTACATGTTGCTTATTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-65s21c2
Sequence:CCGGGCAACATGTAAGATGTCAGAACTCGAGTTCTGACATCTTACATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319101    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017665.1-894s21c1
Sequence:CCGGGCAGTGGATTTCTAATGCTTTCTCGAGAAAGCATTAGAAATCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-319s21c1
Sequence:CCGGCAGAGAGTGAAGAAACATCTACTCGAGTAGATGTTTCTTCACTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017665.1-54s21c1
Sequence:CCGGGAAGCGAATAAGCAACATGTACTCGAGTACATGTTGCTTATTCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks