EMAIL THIS PAGE TO A FRIEND

ZCCHC11

zinc finger, CCHC domain containing 11

Synonyms: PAPD3 TUT4
Gene ID:
Human(23318) Summary: ZCCHC11 is an RNA uridyltransferase (EC 2.7.7.52) that uses UTP to add uridines to the 3-prime end of substrate RNA molecules (Jones et al., 2009 [PubMed 19701194]
Mouse(230594) zinc finger, CCHC domain containing 11
Rat(313481) zinc finger, CCHC domain containing 11
sheep(101115584) zinc finger, CCHC domain containing 11
naked mole-rat(101710204) zinc finger, CCHC domain containing 11
Domestic Rabbit(100355629) zinc finger, CCHC domain containing 11
domestic guinea pig(100729869) zinc finger, CCHC domain containing 11
Zebrafish(323683) zinc finger, CCHC domain containing 11
chicken(424642) zinc finger, CCHC domain containing 11
dog(475349) zinc finger, CCHC domain containing 11
Horse(100050669) zinc finger, CCHC domain containing 11
domestic cat(101092037) zinc finger, CCHC domain containing 11
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175472 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175472 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175472 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU157521 MISSION® esiRNA esiRNA human ZCCHC11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001009881 Rosetta Predictions human pricing
NM_001009882 Rosetta Predictions human pricing
NM_015269 Rosetta Predictions human pricing
NM_001107953 Rosetta Predictions rat pricing
NM_175472 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054342 predicted 4674
2 SASI_Hs02_00305695 predicted 1623
3 SASI_Hs01_00054343 predicted 1086
4 SASI_Hs01_00054344 predicted 3059
5 SASI_Hs02_00305696 predicted 3687
6 SASI_Hs02_00305697 predicted 1664
7 SASI_Hs01_00054346 predicted 1646
8 SASI_Hs02_00305698 predicted 1073
9 SASI_Hs01_00054347 predicted 3846
10 SASI_Hs01_00054351 predicted 3483
11 SASI_Hs01_00054345 predicted 3257
12 SASI_Hs01_00054348 predicted 5084
13 SASI_Hs01_00054349 predicted 1411
14 SASI_Hs01_00054350 predicted 3536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193752 predicted 4657
2 SASI_Hs02_00305699 predicted 1622
3 SASI_Hs01_00193753 predicted 1083
4 SASI_Hs01_00193754 predicted 3061
5 SASI_Hs02_00305700 predicted 3693
6 SASI_Hs02_00305701 predicted 1658
7 SASI_Hs01_00193756 predicted 1647
8 SASI_Hs02_00305702 predicted 1075
9 SASI_Hs01_00193757 predicted 3841
10 SASI_Hs01_00193761 predicted 3486
11 SASI_Hs01_00193755 predicted 3257
12 SASI_Hs01_00193758 predicted 5065
13 SASI_Hs01_00193759 predicted 1408
14 SASI_Hs01_00193760 predicted 3538
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219846 predicted 4671
2 SASI_Hs02_00347424 predicted 1616
3 SASI_Hs01_00219847 predicted 1081
4 SASI_Hs01_00219848 predicted 3061
5 SASI_Hs02_00347425 predicted 3685
6 SASI_Hs02_00347426 predicted 1660
7 SASI_Hs01_00219850 predicted 1647
8 SASI_Hs02_00347427 predicted 1077
9 SASI_Hs01_00219851 predicted 3844
10 SASI_Hs01_00219855 predicted 3486
11 SASI_Hs01_00219849 predicted 3255
12 SASI_Hs01_00219852 predicted 5081
13 SASI_Hs01_00219853 predicted 1407
14 SASI_Hs01_00219854 predicted 3542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107953 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233915 predicted 530
2 SASI_Rn02_00233916 predicted 3266
3 SASI_Rn02_00233917 predicted 1691
4 SASI_Rn02_00233918 predicted 1241
5 SASI_Rn02_00233919 predicted 1021
6 SASI_Rn02_00233920 predicted 2839
7 SASI_Rn02_00233921 predicted 2663
8 SASI_Rn02_00233922 predicted 2674
9 SASI_Rn02_00233923 predicted 1902
10 SASI_Rn02_00233924 predicted 4265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175472 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129477 predicted 3947
2 SASI_Mm01_00129478 predicted 3370
3 SASI_Mm01_00129479 predicted 4891
4 SASI_Mm01_00129480 predicted 3361
5 SASI_Mm01_00129481 predicted 2055
6 SASI_Mm02_00346384 predicted 1690
7 SASI_Mm01_00129483 predicted 3183
8 SASI_Mm01_00129484 predicted 1391
9 SASI_Mm02_00346385 predicted 3807
10 SASI_Mm01_00129485 predicted 5048
11 SASI_Mm01_00129482 predicted 2760
12 SASI_Mm01_00129486 predicted 3563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015269
VALIDATED
ZCCHC11 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 11
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015269.1-2753s21c1
Sequence:CCGGAGTCGCCTGACCCAGATAAATCTCGAGATTTATCTGGGTCAGGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015269.1-5541s21c1
Sequence:CCGGATTAGCTGTATTCATACTTTGCTCGAGCAAAGTATGAATACAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015269.1-5326s21c1
Sequence:CCGGACACGTTTAGATAGCTTATTTCTCGAGAAATAAGCTATCTAAACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015269.1-5253s1c1
Sequence:CCGGGTCAGTTACATTCAGCAGAAACTCGAGTTTCTGCTGAATGTAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-2878s1c1
Sequence:CCGGGCTTCTGACCTTAATGATGATCTCGAGATCATCATTAAGGTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-876s1c1
Sequence:CCGGGCAACAGACATGTACAGATAACTCGAGTTATCTGTACATGTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015269.1-3490s1c1
Sequence:CCGGGCTACTTATGCAGCTATTGATCTCGAGATCAATAGCTGCATAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-3250s1c1
Sequence:CCGGCGTGATAGTGATCTGGATATTCTCGAGAATATCCAGATCACTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015269
VALIDATED
ZCCHC11 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 11
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015269.1-2753s21c1
Sequence:CCGGAGTCGCCTGACCCAGATAAATCTCGAGATTTATCTGGGTCAGGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015269.1-5541s21c1
Sequence:CCGGATTAGCTGTATTCATACTTTGCTCGAGCAAAGTATGAATACAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015269.1-5326s21c1
Sequence:CCGGACACGTTTAGATAGCTTATTTCTCGAGAAATAAGCTATCTAAACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015269.1-5253s1c1
Sequence:CCGGGTCAGTTACATTCAGCAGAAACTCGAGTTTCTGCTGAATGTAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-2878s1c1
Sequence:CCGGGCTTCTGACCTTAATGATGATCTCGAGATCATCATTAAGGTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-876s1c1
Sequence:CCGGGCAACAGACATGTACAGATAACTCGAGTTATCTGTACATGTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015269.1-3490s1c1
Sequence:CCGGGCTACTTATGCAGCTATTGATCTCGAGATCAATAGCTGCATAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-3250s1c1
Sequence:CCGGCGTGATAGTGATCTGGATATTCTCGAGAATATCCAGATCACTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015269
VALIDATED
ZCCHC11 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 11
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015269.1-2753s21c1
Sequence:CCGGAGTCGCCTGACCCAGATAAATCTCGAGATTTATCTGGGTCAGGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015269.1-5541s21c1
Sequence:CCGGATTAGCTGTATTCATACTTTGCTCGAGCAAAGTATGAATACAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423930    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015269.1-5326s21c1
Sequence:CCGGACACGTTTAGATAGCTTATTTCTCGAGAAATAAGCTATCTAAACGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150277    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015269.1-5253s1c1
Sequence:CCGGGTCAGTTACATTCAGCAGAAACTCGAGTTTCTGCTGAATGTAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-2878s1c1
Sequence:CCGGGCTTCTGACCTTAATGATGATCTCGAGATCATCATTAAGGTCAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-876s1c1
Sequence:CCGGGCAACAGACATGTACAGATAACTCGAGTTATCTGTACATGTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015269.1-3490s1c1
Sequence:CCGGGCTACTTATGCAGCTATTGATCTCGAGATCAATAGCTGCATAAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_015269.1-3250s1c1
Sequence:CCGGCGTGATAGTGATCTGGATATTCTCGAGAATATCCAGATCACTATCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175472
ZCCHC11 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-5202s21c1
Sequence:CCGGGCCACGCTTTCGAGGACTAAACTCGAGTTTAGTCCTCGAAAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-2649s21c1
Sequence:CCGGCAGAGCAGCTTATCGATATTTCTCGAGAAATATCGATAAGCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175472.3-5554s21c1
Sequence:CCGGACACGTTTAGATAGCTTATTTCTCGAGAAATAAGCTATCTAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-2057s21c1
Sequence:CCGGGGGCTAAGCTGTGCTATATTGCTCGAGCAATATAGCACAGCTTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-3369s21c1
Sequence:CCGGGACAAACCGATTTCGAGAAATCTCGAGATTTCTCGAAATCGGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175472
ZCCHC11 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-5202s21c1
Sequence:CCGGGCCACGCTTTCGAGGACTAAACTCGAGTTTAGTCCTCGAAAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-2649s21c1
Sequence:CCGGCAGAGCAGCTTATCGATATTTCTCGAGAAATATCGATAAGCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175472.3-5554s21c1
Sequence:CCGGACACGTTTAGATAGCTTATTTCTCGAGAAATAAGCTATCTAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-2057s21c1
Sequence:CCGGGGGCTAAGCTGTGCTATATTGCTCGAGCAATATAGCACAGCTTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-3369s21c1
Sequence:CCGGGACAAACCGATTTCGAGAAATCTCGAGATTTCTCGAAATCGGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175472
ZCCHC11 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-5202s21c1
Sequence:CCGGGCCACGCTTTCGAGGACTAAACTCGAGTTTAGTCCTCGAAAGCGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-2649s21c1
Sequence:CCGGCAGAGCAGCTTATCGATATTTCTCGAGAAATATCGATAAGCTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175472.3-5554s21c1
Sequence:CCGGACACGTTTAGATAGCTTATTTCTCGAGAAATAAGCTATCTAAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241803    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-2057s21c1
Sequence:CCGGGGGCTAAGCTGTGCTATATTGCTCGAGCAATATAGCACAGCTTAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175472.3-3369s21c1
Sequence:CCGGGACAAACCGATTTCGAGAAATCTCGAGATTTCTCGAAATCGGTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks