EMAIL THIS PAGE TO A FRIEND

ZCCHC12

zinc finger, CCHC domain containing 12

Synonyms: PNMA7A SIZN SIZN1
UniProtKB ID: Q6PEW1, B3KV48, Q6PID5, Q8N1C1
Gene ID:
Mouse(72693) zinc finger, CCHC domain containing 12
Rat(313436) zinc finger, CCHC domain containing 12
Horse(100053678) zinc finger, CCHC domain containing 12
domestic cat(101091603) zinc finger, CCHC domain containing 12
dog(492090) zinc finger, CCHC domain containing 12
domestic guinea pig(100729163) zinc finger, CCHC domain containing 12
naked mole-rat(101724086) zinc finger, CCHC domain containing 12
cow(540006) zinc finger, CCHC domain containing 12
sheep(101107078) zinc finger, CCHC domain containing 12
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173798 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173798 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173798 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173798 Rosetta Predictions human pricing
NM_001014065 Rosetta Predictions rat pricing
NM_028325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173798 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368652 predicted 555
2 SASI_Hs01_00098607 predicted 942
3 SASI_Hs01_00098609 predicted 1102
4 SASI_Hs01_00098610 predicted 906
5 SASI_Hs01_00098611 predicted 938
6 SASI_Hs01_00098612 predicted 1501
7 SASI_Hs01_00098613 predicted 1125
8 SASI_Hs01_00098614 predicted 1098
9 SASI_Hs01_00098615 predicted 688
10 SASI_Hs01_00098616 predicted 1407
11 SASI_Hs01_00098608 predicted 1504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00116644 predicted 771
2 SASI_Rn01_00116645 predicted 592
3 SASI_Rn01_00116646 predicted 1000
4 SASI_Rn01_00116647 predicted 1653
5 SASI_Rn01_00116648 predicted 1145
6 SASI_Rn02_00201462 predicted 955
7 SASI_Rn01_00116649 predicted 810
8 SASI_Rn01_00116650 predicted 998
9 SASI_Rn01_00116652 predicted 1152
10 SASI_Rn01_00116653 predicted 1128
11 SASI_Rn01_00116651 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00054756 predicted 1077
2 SASI_Mm01_00054757 predicted 1730
3 SASI_Mm01_00054758 predicted 1643
4 SASI_Mm01_00054759 predicted 1017
5 SASI_Mm01_00054760 predicted 1236
6 SASI_Mm01_00054761 predicted 465
7 SASI_Mm01_00054763 predicted 1244
8 SASI_Mm01_00054764 predicted 677
9 SASI_Mm01_00054765 predicted 765
10 SASI_Mm02_00333692 predicted 706
11 SASI_Mm01_00054762 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173798
ZCCHC12 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 12
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1646s1c1
Sequence:CCGGCCCTGGCGAATACAATGACTTCTCGAGAAGTCATTGTATTCGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1652s1c1
Sequence:CCGGCGAATACAATGACTTCTCTGACTCGAGTCAGAGAAGTCATTGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173798.2-1693s1c1
Sequence:CCGGCCAGGTTTCAGTGAACCCTTACTCGAGTAAGGGTTCACTGAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-790s1c1
Sequence:CCGGCTAACCTAAGTGTGGCAGATTCTCGAGAATCTGCCACACTTAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1101s1c1
Sequence:CCGGCTGGAGTTAATCAGAATGGTACTCGAGTACCATTCTGATTAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173798.2-1915s1c1
Sequence:CCGGCCATTTCCTTGACAGCTTTATCTCGAGATAAAGCTGTCAAGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173798.2-1914s1c1
Sequence:CCGGCCCATTTCCTTGACAGCTTTACTCGAGTAAAGCTGTCAAGGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173798.2-1089s1c1
Sequence:CCGGCTTCCCAACTTTCTGGAGTTACTCGAGTAACTCCAGAAAGTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-948s21c1
Sequence:CCGGGCTATTCAGGCAGGCATTATACTCGAGTATAATGCCTGCCTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173798.2-1701s21c1
Sequence:CCGGCAGTGAACCCTTACCTATATTCTCGAGAATATAGGTAAGGGTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-1437s21c1
Sequence:CCGGAGTGGTGGTTCTGGCTATAAGCTCGAGCTTATAGCCAGAACCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-1501s21c1
Sequence:CCGGACACAATCCGCTGTTCGTATTCTCGAGAATACGAACAGCGGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-563s21c1
Sequence:CCGGGAGAAGTCTCGGTCCTATAATCTCGAGATTATAGGACCGAGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173798
ZCCHC12 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 12
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1646s1c1
Sequence:CCGGCCCTGGCGAATACAATGACTTCTCGAGAAGTCATTGTATTCGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1652s1c1
Sequence:CCGGCGAATACAATGACTTCTCTGACTCGAGTCAGAGAAGTCATTGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173798.2-1693s1c1
Sequence:CCGGCCAGGTTTCAGTGAACCCTTACTCGAGTAAGGGTTCACTGAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-790s1c1
Sequence:CCGGCTAACCTAAGTGTGGCAGATTCTCGAGAATCTGCCACACTTAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1101s1c1
Sequence:CCGGCTGGAGTTAATCAGAATGGTACTCGAGTACCATTCTGATTAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173798.2-1915s1c1
Sequence:CCGGCCATTTCCTTGACAGCTTTATCTCGAGATAAAGCTGTCAAGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173798.2-1914s1c1
Sequence:CCGGCCCATTTCCTTGACAGCTTTACTCGAGTAAAGCTGTCAAGGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173798.2-1089s1c1
Sequence:CCGGCTTCCCAACTTTCTGGAGTTACTCGAGTAACTCCAGAAAGTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-948s21c1
Sequence:CCGGGCTATTCAGGCAGGCATTATACTCGAGTATAATGCCTGCCTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173798.2-1701s21c1
Sequence:CCGGCAGTGAACCCTTACCTATATTCTCGAGAATATAGGTAAGGGTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-1437s21c1
Sequence:CCGGAGTGGTGGTTCTGGCTATAAGCTCGAGCTTATAGCCAGAACCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-1501s21c1
Sequence:CCGGACACAATCCGCTGTTCGTATTCTCGAGAATACGAACAGCGGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-563s21c1
Sequence:CCGGGAGAAGTCTCGGTCCTATAATCTCGAGATTATAGGACCGAGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173798
ZCCHC12 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 12
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1646s1c1
Sequence:CCGGCCCTGGCGAATACAATGACTTCTCGAGAAGTCATTGTATTCGCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1652s1c1
Sequence:CCGGCGAATACAATGACTTCTCTGACTCGAGTCAGAGAAGTCATTGTATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136918    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173798.2-1693s1c1
Sequence:CCGGCCAGGTTTCAGTGAACCCTTACTCGAGTAAGGGTTCACTGAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-790s1c1
Sequence:CCGGCTAACCTAAGTGTGGCAGATTCTCGAGAATCTGCCACACTTAGGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173798.2-1101s1c1
Sequence:CCGGCTGGAGTTAATCAGAATGGTACTCGAGTACCATTCTGATTAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134059    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173798.2-1915s1c1
Sequence:CCGGCCATTTCCTTGACAGCTTTATCTCGAGATAAAGCTGTCAAGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173798.2-1914s1c1
Sequence:CCGGCCCATTTCCTTGACAGCTTTACTCGAGTAAAGCTGTCAAGGAAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173798.2-1089s1c1
Sequence:CCGGCTTCCCAACTTTCTGGAGTTACTCGAGTAACTCCAGAAAGTTGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-948s21c1
Sequence:CCGGGCTATTCAGGCAGGCATTATACTCGAGTATAATGCCTGCCTGAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173798.2-1701s21c1
Sequence:CCGGCAGTGAACCCTTACCTATATTCTCGAGAATATAGGTAAGGGTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-1437s21c1
Sequence:CCGGAGTGGTGGTTCTGGCTATAAGCTCGAGCTTATAGCCAGAACCACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-1501s21c1
Sequence:CCGGACACAATCCGCTGTTCGTATTCTCGAGAATACGAACAGCGGATTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271434    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173798.2-563s21c1
Sequence:CCGGGAGAAGTCTCGGTCCTATAATCTCGAGATTATAGGACCGAGACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028325
ZCCHC12 MISSION shRNA Bacterial Glycerol Stock
zinc finger, CCHC domain containing 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-1172s1c1
Sequence:CCGGGAGATAGATGACTCTCCTGATCTCGAGATCAGGAGAGTCATCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-1007s1c1
Sequence:CCGGCTAGAGTTAATCAGGATGATACTCGAGTATCATCCTGATTAACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028325.1-1777s1c1
Sequence:CCGGCCACTGCTTAACAGTCTATTTCTCGAGAAATAGACTGTTAAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-469s1c1
Sequence:CCGGGAGGAGTCTTGGCCCTTTAATCTCGAGATTAAAGGGCCAAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028325.1-993s1c1
Sequence:CCGGGCCTTCCCAATTTCCTAGAGTCTCGAGACTCTAGGAAATTGGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028325.1-1776s1c1
Sequence:CCGGCCCACTGCTTAACAGTCTATTCTCGAGAATAGACTGTTAAGCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028325.3-1219s1c1
Sequence:CCGGCCAATAATGATCAGCAGTATCCTCGAGGATACTGCTGATCATTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028325
ZCCHC12 MISSION shRNA shRNA Plasmid DNA
zinc finger, CCHC domain containing 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-1172s1c1
Sequence:CCGGGAGATAGATGACTCTCCTGATCTCGAGATCAGGAGAGTCATCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-1007s1c1
Sequence:CCGGCTAGAGTTAATCAGGATGATACTCGAGTATCATCCTGATTAACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028325.1-1777s1c1
Sequence:CCGGCCACTGCTTAACAGTCTATTTCTCGAGAAATAGACTGTTAAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-469s1c1
Sequence:CCGGGAGGAGTCTTGGCCCTTTAATCTCGAGATTAAAGGGCCAAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028325.1-993s1c1
Sequence:CCGGGCCTTCCCAATTTCCTAGAGTCTCGAGACTCTAGGAAATTGGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028325.1-1776s1c1
Sequence:CCGGCCCACTGCTTAACAGTCTATTCTCGAGAATAGACTGTTAAGCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028325.3-1219s1c1
Sequence:CCGGCCAATAATGATCAGCAGTATCCTCGAGGATACTGCTGATCATTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028325
ZCCHC12 MISSION shRNA Lentiviral Transduction Particles
zinc finger, CCHC domain containing 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-1172s1c1
Sequence:CCGGGAGATAGATGACTCTCCTGATCTCGAGATCAGGAGAGTCATCTATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-1007s1c1
Sequence:CCGGCTAGAGTTAATCAGGATGATACTCGAGTATCATCCTGATTAACTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175226    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028325.1-1777s1c1
Sequence:CCGGCCACTGCTTAACAGTCTATTTCTCGAGAAATAGACTGTTAAGCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028325.1-469s1c1
Sequence:CCGGGAGGAGTCTTGGCCCTTTAATCTCGAGATTAAAGGGCCAAGACTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194471    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028325.1-993s1c1
Sequence:CCGGGCCTTCCCAATTTCCTAGAGTCTCGAGACTCTAGGAAATTGGGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193829    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_028325.1-1776s1c1
Sequence:CCGGCCCACTGCTTAACAGTCTATTCTCGAGAATAGACTGTTAAGCAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_028325.3-1219s1c1
Sequence:CCGGCCAATAATGATCAGCAGTATCCTCGAGGATACTGCTGATCATTATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks